Abstract
Antagonistic rhizobacteria, more specifically fluorescent pseudomonads and certain species of Bacillus, are known to control of fungal root diseases of agronomic crops. In this study, 144 bacteria were isolated from cucumber rhizosphere and screened as potential biological control agents against Phytophthora drechsleri, causal agent of cucumber root rot, in vitro and greenhouse condition. On the basis of dual culture assays, eight isolates were selected for root colonization, PGPR and greenhouse studies. Among these isolates, isolate CV6 exhibited the highest colonization on the roots and significantly promoted plant growth under in vitro condition. In greenhouse studies mortality in pots treated with strain CV6 was very low and percent of healthy plants were 85.71%. Based on biochemical and physiologic tests and 16SrDNA homology, this isolate identified as Pseudomonas fluorescensstrain CV6. Strain CV6 was shown to have broad spectrum in vitro antibiotic activity against 11 additional plant pathogens. It was able to produce considerable amount of siderophore and acid indole-3-acetic acid (IAA). With the addition of tryptophan from 50 to 500 mg/ml the production of IAA was increased up to 15.3 �g/ml. The bacterium showed positive reactions for HCN, catalase, protease, and phosphatase, and negative for the production of pectinase, lipase and cellulase. Results from this study provide comprehensive information on nutritional requirements and biocontrol mechanisms of strain CV6 that can be used for commercial use and appropriate application of this bacterium.
Keywords: biological control, antagonists, PGPR, colonization, HCN, siderophore
(ProQuest: ... denotes formula omitted.)
Introduction
The rhizosphere, representing the thin layer of soil surrounding plant roots and the soil occupied by the roots, supports large active groups of bacteria (Villacieros et al., 2003) known as plant growth promoting rhizobacteria (PGPR) (Kloepper et al., 1980). Plant growth promoting rhizobacteria are known to rapidly colonize the rhizosphere and suppress soilborne pathogens at the root surface (Rangajaran et al., 2003). These organisms can also be beneficial to the plant by stimulating growth (Bloemberg and Lugtenberg, 2001; Moeinzadeh et al., 2010). Among these organisms, Fluorescent Pseudomonads are considered to be the most promising group of plant growthpromoting rhizobacteria involved in biocontrol of plant diseases (Gardner et al., 1984; Moeinzadeh et al., 2010). They produce secondary metabolites such as antibiotics (Keel et al., 1992), phytohormones (Keel et al., 1992), volatile compound Hydrogen cyanide (HCN) (Defago and Haas 1990), and siderophores (Neiland, 1995). Plant growth-promoting ability of these bacteria is mainly because of the production of indole-3- acetic acid (IAA; Patten and Glick 2002), siderophores (Schippers et al., 1987) and antibiotics (Colyer and Mount 1984). Production of antibiotics such as phenazine-1-carboxylic acid (PCA), pyocyanin, 2-acetamidophenol, pyrrolnitrin, pyoluteorin, Phenazine-1-Carboxylic Acid, 2,4-diacetylphloroglucinol, viscosinamide and tensin in different species of pseudomonads has been reported (Sunish Kumar et al., 2005). Production of siderophores has also been linked to the diseasesuppressing ability of certain fluorescent Pseudomonas species (Loper and Buyer, 1991). The control of phytophthora root rot of soybean (Lifshitz et al., 1987), tobacco black root rot (Keel et al., 1989), fungal diseases of orange, lemon citrus roots (Gardner et al., 1984), and ornamental plants (Yuen and Schorth, 1986) has been demonstrated with fluorescent Pseudomonads. In the present study, a soil isolate CV6, identified according to chemotaxonomic characterizations as well as 16S rDNA gene sequence analysis. The possible growth-promoting and biocontrol potential of the aforementioned strain has been investigated by determining the secondary metabolites, viz. IAA, siderophore, and HCN production.
Material and methods
Microbial cultures and media
Fluorescent pseudomonad strains, Pseudomonas fluorescens PF5, P. fluorescens CHA0, P. fluorescens 2-79, and P. aeruginosa 7NSK2, and plant pathogenic fungal strains, were obtained from the collection of microbial culture (Department of Plant Protection, University of Tehran, Karaj, Iran). Stock cultures of bacteria were prepared for storage at -80�C in 1.5 ml vials by mixing equal volumes of 50 % glycerol and 24-h culture broth [from single colony inoculum, 25ml LB medium, 100ml flask, 130 rpm]. Fungal strains after growth on slants of potato dextrose agar (PDA) were maintained under liquid paraffin.
Isolation and screening of fluorescent bacteria
In April 2009, a total of 50 cucumber plants were collected from fields and greenhouses of Varamin, Tehran province of Iran. Roots gently removed from soil and placed in plastic bags before they were transported to the laboratory. Adhering soil was carefully brushed off the plant roots, followed by gentle washing of the roots in sterile water. One gram of roots was placed in 9 ml of 0.1 M phosphate buffer (pH 7) supplemented with 0.025% Tween 20 and vortexed for 5 min. Then, 100 �l of first to forth diluents transferred to Gould's S1 medium (CA) plates and incubated at 27 �C for 2 days. Single colonies that fluoresced under UV light (366 nm) were selected and further cultured to establish pure cultures. The in vitro inhibition of mycelial growth of Ph. drechsleri by isolates was tested by using the dual culture technique as described by Ahmed Idris et al., (2007). Volatile compounds produced by bacteria were detected in a split plate experiment (Kraus and loper 1992). The isolates, which showed antagonistic activity in the dual culture and split plate assays, were tested for their ability to promotion of plant growth and colonize the roots by using the methods describe by Ahmadzadeh and Shrifi-Tehrani (2009). The ability of isolates to suppress Phytophthora damping-off of cucumber in greenhouse was examined on Cucumis sativus L. Soltan cultivar. Seven surface sterilized (2.5% NaOCl, 3 min) seeds of Soltan cultivar seeded in polyethylene pots (8 cm in diameter) filled with a 1:1:2 mixture of peat, sand and soil from Varamin, Iran. Then, the pots were transferred to the greenhouse (16 h of light and 25-27�C) watered at a three-day interval and kept for 10 days. Ten days after seeding, pots were topped up with 30 g of the potting mix that had been blended with white bean seed inoculum of Ph. drechsleri and drenched with 20 ml of bacterial suspensions or a solution of 1 g L-1 Ridomil MZ-72 WP. Then pots were watered and arranged in a randomized complete block design and incubated in mentioned condition. The treatments in this experiment were: Pots inoculation with Ph. drechsleri and bacteria, inoculation with Ph. drechsleri and mix of bacterial strains, inoculation with Ph. drechsleri and Ridomil, inoculation only with Ph. drechsleri but no bacteria (CI) and control without inoculation (C). There were four pots for each treatment. After 2 and 3 weeks, percentage of the healthy plants was determined. After last assessment of disease severity, plants were removed from pots and fresh and dry weight parameters of them were measured.
Identification of strain CV6, on the basis of biochemical and physiological characterization
Strain CV6 was identified on the basis of tests for cytochrome oxidase (Kovacs, 1956), arginine dihydrolase (Thornley, 1960), gelatin liquefaction (Dye, 1968), production of diffusible nonfluorescent pigment (pyocyanin) on King's A medium (King et al., 1954), tobacco HR (Klement, 1963), nitrate reduction, growth at 4 and 41�C, levan production, (Shaad et al., 2001) and the ability to growth on carbon sources such as Larabinose, D-galactose, trehalose, meso-inositol, sorbitol, Ltartrate was tested with the basal medium of Ayers et al., (1919).
16S rDNA gene sequencing
Genomic DNA of CV6 was extracted and purified according to the method described by Wang et al., (2001). 16S rDNA was amplified from CV6 genomic DNA with the primers PS16f 5?TGGCTCAGATTGAACGCTGGCGG-3?and PS16r5?- GATCCAGCCGCAGGTTCCCCT AC -3?. PCR amplification was carried out in 20 �l reaction mixtures containing 4 �l of lysed bacterial suspension, 1� PCR bovine serum albumin, 5% dimethyl sulfoxide, 100 �M each of dATP, dCTP, dGTP and dTTP, 0.40 �M of each primer and 1.4 U of Taq DNA polymerase Amplifications were performed with a Corpet research g001 cycler. The initial denaturation (2 min at 94 �C) was followed by 30 PCR cycles (94 �C for 30 s, 60 �C for 30 s and 72 �C for 60 s) and a final extension at 72 �C for 10 min. The amplified DNA was purified using polymerase chain reaction (PCR) purification kit (Promega, Madison, WI, USA), diluted to 200 ng �1-1, and was sequenced at Microsynth Inc. (Balgach, Switzerland).
Assessment of antiphytopathogenic activity against several phytopathogens
The antagonistic ability of P. fluorescens CV6 was checked against 12 phytopathogenic fungi, according the method described by Ahmed Idris et al., (2007) Three 10 �l drops from the 108 cfu/ ml suspension were equidistantly placed on the margins of potato dextrose agar (PDA) plates and incubated at 28 �C for 24 h. A 6 mm agar disc from fresh cultures of Ph. drechsleri was placed at the centre of the PDA plate for each bacterial isolate and incubated at 27 � 1 �C for seven days. The radii of the fungal colony towards and away from the bacterial colony were measured. The percentage growth inhibition was calculated using the following formula:
...
Where, r is the radius of the fungal colony opposite the bacterial colony and, R is the maximum radius of the fungal colony away from the bacterial colony. There were three replicate in this assay.
Detection and production of siderophore
The siderophore production was determined by Chrome Azurol S (CAS) assay (Alexander and Zuberer, 1991). Culture of test strain CV6 was grown in M9 minimal medium (Sambrook et al., 1989) at 27�C to a density of 108 CFU/ml. Cells in late log phase were removed by centrifugation at 3000 rpm, and the filtrate was tested for siderophore on CAS agar plates. Also, the quantitative estimation was performed according to the method of Chambers et al., (1996). Specific tests were carried out for quatification of pyoverdine according to the method of Meyer and Abdallah (1978). There were three replicate in this assay.
Assay for indole acetic acid (IAA) production
Quantitative analysis of IAA was performed using the method of Loper and Scroth (1986) at different concentrations of tryptophan (0, 50, 150, 300, 400 and 500 mg/ml). Bacterial cultures were grown for 48 h in nutrient broth (peptone, 5 g; yeast extract, 1.5 g; beef extract, 1.5 g; and NaCl, 5 g; each per liter).
Fully grown cultures were centrifuged at 3000 rpm for 30 min. The supernatant (2 ml) was mixed with two drops of orthophosphoric acid and 4ml of Salkowski reagent (50 ml, 35% of perchloric acid, 1 ml 0.5 M FeCl3 solution). Development of pink color indicates IAA production. Optical density was taken at 530 nm with a spectrophotometer (T70+ UV/VIS, PG instruments). Concentration of IAA produced by cultures was measured with the help of standard graph of IAA (Hi-media) obtained in the range of 10-100 mg/ml. There were three replicates in this experiment.
Assays for hydrolytic activity and detection of HCN
Cellulase and pectinase production by the strain was determined as described by Cattelan et al., (1999). M9 medium agar (Miller, 1974) amended with 10 g of cellulose and 1.2 g of yeast extract per liter of distilled water was used to test the cellulase activity, in which a clear halo after 8 days of incubation of the colonies at 28�C was considered as positive for cellulase production. For determining the pectinase activity, 10 g pectin plus 1.2 g yeast extract was amended in M9 medium agar and the plates were flooded with 2 M HCl after 2 days of incubation at 28�C. Clear halos around the colonies were considered as positive for pectinase production. Lipase medium was used to check the lipase production, which was indicated by clear zones surrounding the colonies (Smibert and Krieg 1994). Phosphatase activity was determined by development of a clear zone in Pikovskaya's agar medium after 2-5 days incubation of assay plates at 28�C (Pikovskaya 1948). Proteolytic activity was determined by using skimmed milk agar (pancreatic digest of casein 5 g, yeast extract 2.5 g, glucose 1 g, 7% skim milk solution 100 ml, agar 15 g dissolved in 1 l distilled water) (Sunish Kumar et al. 2005). After 2 days incubation at 28�C, a clear zone around the cells indicated positive proteolytic activity (Smibert and Krieg 1994). Production of HCN by CV6 on KB media with different concentrations of iron was observed according to the method of Lorck (1948). There were three replicates in all assays.
Results
Isolation and screening of fluorescent bacteria
According to the table 1 (isolates with no inhibition were not included), among of the 144 bacterial isolates, 23 isolates exhibited more than 30% inhibition of mycelia growth of Ph. drechsleri by non-volatile inhibitors. The maximum inhibition achieved by any isolate was 55.56% (CV3). Control plates not treated with the bacterial isolates were completely covered by the phytopathogens showing no inhibition (Table1). In tests for detection of volatile metabolites by isolates, eight isolates exhibited a more than 25% of mycelia growth of Ph. drechsleri. The maximum inhibition achieved by any isolate was 39.33% (V69). Isolates CV3, CV6, V11, V14, V69, V28, V16 and V64 were amongst the most effective isolates against Ph. drechsleri and selected for greenhouse studies. Isolates V16 and V64 produced noticeable amount of the volatile metabolites which inhibited mycelial growth by more than 30% (Table 1). The effect of bacterial isolates on the growth of seedlings was monitored by measuring of length and weight of the root and stem (Table 2). All strains except V69 promoted plant growth significantly compared to the untreated control. Strains CV6, V14 and V28 caused to increase the length of stem and root, considerably. In addition, strains CV6, V14 and V64 showed the most effect to enhance the foliar weight of cucumber seedling. However, both strains, CV6 and V14, exhibited the greatest effect to enhance root weight of seedling. In vitro root study of the colonization, demonstrated that some of the strains have more ability to root colonization than others. The population density on roots of plants treated with CV6 and V11 reached to 8.03 and 7.76 log10 CFU g-1 root respectively (Table 2). Strains V69 and V64 were not effective colonizers as their cell count was less than 5 log10 CFU g-1 root. Statistical analysis exhibited that there is a significant correlation between root colonization talent of strains and their growth promoting ability, as in most cases the strains with a higher efficacy of root colonization resulted in the more growth of plants (Table 3).
In greenhouse studies, mortality in pots treated with strain CV6 and V11 was very low and three weeks after treatment of pots with pathogen, percent of healthy plants in these treatments was 85.71 and 69.39%, respectively (Figure 1). Percent of healthy plants in pots treated with CV6 significantly was more than those treated with Ridomil. Moreover, there was no significant difference between fresh and dry weight of plants treated with isolate CV6 and non-infected control plants (Data not shown).
Identification and characterization of strain CV6
The result of biochemical and physiologic testing is listed in Table 4. Strain CV6 showed positive reactions of oxidase, gelatinase, nitrate reductase, arginine dihydrolase and levan production but it was negative for tobacco HR and growth at 41 �C. Primers, PS16f and PS16r amplified a complete DNA fragment of 1.49 kb 16S rDNA when the total genomic DNA of CV6 was used as template in PCR. The 16S rRNA gene sequence of this strain exhibited 99.1 % similarity to that of P. fluorescens.
Antiphytopathogenic activity of CV6 against several phytopathogens
P. fluorescens CV6 was shown to have broad spectrum in vitro antibiotic activity against 11 additional plant pathogens (Table 5). Fusarium oxysporum f. sp. lycopersici and Alternaria solani were the only pathogens tested that were not inhibited.
Detection and production of siderophore and IAA
The strain CV6 also showed the production of siderophore on CAS agar plates. Appearance of a reddish-brown zone surrounding the colony on CAS agar plates clearly suggests siderophore production by this strain. Strains P. fluorescens PF5, P. fluorescens CHA0, P. fluorescens 2-79, and P. aeruginosa 7NSK2 were used as reference strains. CAS activity by CV6 was significantly more than those of all the reference strains except 7NSK2 (Table 6). Specific tests were carried out for quantification of pyoverdine. Pyoverdine production by strain CV6 was significantly higher than those of CHA0 and PF5 but not those of other reference strains (Figure 2).
Strain CV6 was tested for the quantitative estimation of IAA in the presence of different concentrations of tryptophan (Figure 3). With no addition of tryptophan, production of IAA was not observed. With the addition of tryptophan from 50 to 500 mg/ ml the production of IAA was increased up to 15.3 �g/ml.
Assays for hydrolytic activity and detection of HCN
A remarkable change in color from yellow to reddish-brown with strain CV6 compared with the control indicates HCN production. The data revealed a decreased level of HCN production under low iron conditions (Table 7). Production of HCN by strain CHA0 was drastically dependent on iron concentration in the medium. Strain 7NSK2 was not able to produce HCN. Strain CV6 showed positive reactions for catalase, protease, and phosphatase, and negative for the production of pectinase, lipase and cellulase.
Discussion
Over the last decades, many studies have reported on natural activity of some fungi and bacteria against pathogens, and this is considered as a very appealing alternative to the use of chemical fungicides (Gerhardson 2002; Welbaum et al. 2004). The rhizosphere microorganisms, especially fluorescent pseudomonads, have exceptional ability to promote the growth of host plant by various mechanisms (O'Sullivan and O'Gara 1992). Also these bacteria have various mechanisms to suppress plant diseases including production of antibiotics, efficient root colonization and production of powerful siderophores (O'Sullivan and O'Gara 1992; Hass and Defago 2005). In our study, 144 bacterial strains were isolated from soil samples collected from agricultural fields of Varamin regione of Iran. All isolates subjected to several screening procedures for selecting the best strain for effective biocontrol of phytopathogens. Of all the strains tested, isolates CV3, CV6, V11, V14, V69, V28, V16 and V64 were amongst the most effective isolates against Ph. drechsleri and selected for further investigations. However, the main problem of biological control is its low consistency and reliability under field conditions due to a high variability in efficacy (Ojiambo, 2006). The complex in situ condition in the natural rhizosphere influences survival, growth and production of secondary metabolites by the biocontrol strains. One of the important measures in developing reliable biocontrol systems is to identify the biocontrol mechanisms and nutritional and physiological requirements of biocontrol agents to provide these optimum conditions in plant cultivation systems. Detailed characterization of a biocontrol agent is an essential step towards achieving this goal, and towards improving the level and reliability of its biocontrol activity. For example nutritional composition of root exudates in different plants is variable (Lugtenberg and Dekkers, 1999) and knowing the nutritional requirements of biocontrol agents will help us to introduce them to appropriate pathosystems. Moreover knowing the mechanisms of a biocontrol agent allow us to improve its efficacy. In the percent study, the ability of these strains for promotion of plant growth and efficient root colonization was investigated in vitro. Strains V14 and CV6 were able to significantly enhance all measured plant growth parameters. The strains with higher ability of root colonization were more effective in suppressing Phytophthora root rot on cucumber plants (Table 2 and Figure 1). In all most cases, strains with a higher efficacy of root colonization caused to higher growth of plants. In several works, variable performance of introduced rhizobacteria has been attributed to insufficient root colonization, a process whereby the bacteria inoculated onto seed attach to the root surface, and colonize the developing root system (Weller, 1988). On the other hand, the results of greenhouse studies revealed that, strains with higher ability of root colonization were more effective in suppressing Phytophthora root rot on cucumber plants. On the basis of these in vitro and in situ screening procedures, we selected strain CV6 for further investigations and characterization. This strain was identified as P. fluorescens using the biochemical and physiological tests as well as 16S rDNA sequence analysis. This procedure in identification is more accurate than the traditional methods (Weisburg, 1991; Guo et al., 2007). Strain CV6 revealed a broad spectrum antifungal activity against different phythopathogens and it can be used as an effective biological control candidate against devastating fungal pathogens that attack various plant crops. Results from this study exhibited that strain CV6 is partly powerful producer of IAA. There was an increase in the level of IAA with the increasing concentration of tryptophan (50-400 mg/ ml) similarly to the results reported by Barazani and Friedman (2000). IAA is responsible for division, enlargement and differentiation of plant cells and tissues; it plays a major role in xylem- and root formation (Davies, 1995). Auxin biosynthesis is also widespread among soil- and plant-associated bacteria. Moreover, its production is a determinant trait both for plant growth promoting rhizobacteria (PGPR) and plant pathogens (Patten and Glick, 1996, 2002). Another important trait of PGPR, that may indirectly influence the plant growth, is the production of siderophores. Siderophores chelates iron and other metals contribute to disease suppression by conferring a competitive advantage to biocontrol agents for the limited supply of essential trace minerals in natural habitats (Hofte et al., 1992; Loper and Henkels, 1997). Siderophores may directly stimulate the biosynthesis of other antimicrobial compounds by increasing the availability of these minerals to the bacteria. Results from the qualitative and quantitative estimations of siderophore by CV6 showed that, it's a powerful producer of siderophores. Strain CV6 showed positive reactions for catalase, protease, phosphatase and HCN. Solubilization of phosphorous because of phosphatase were found to significantly increase crop yield (Brown 1974) and bacterial strains showing catalase activity must be highly resistant to environmental, mechanical, and chemical stresses (Joseph et al., 2007). Production of HCN by pseudomonads is associated with biological control of the black root rot of tobacco, but other workers observed that it can have a detrimental effect on plant growth (O'Sullivan and O'Gara, 1992).
Acknowledgment
We gratefully acknowledge financial support from the Islamic Azad University of Varamin-Pishva, Varamin.
[Reference]
References
Ahmadzadeh M, Sharifi-Tehrani A (2009) Evaluation of fluorescent pseudomonads for plant growth promotion, antifungal activity against Rhizoctonia solani on common bean, and biocontrol potential. Biological Control 48:101-107
Ahmed Idris H, Labuschagne N, Korsten L (2007) Screening rhizobacteria for biological control of Fusarium root and crown rot of sorghum in Ethiopia. Biological control 40: 97- 106
Alexander DB, Zuberer, DA (1991) Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol. Fertil. Soils. 12:39-45
Ayers SH, Rupp P, Johnson WT (1919) A study of the alkaliforming bacteria in milk. U. S. Dept. of Agric. Bull. 782
Barazani O, Friedman J (2000) Effect of exogeneously applied L-tryptophan on allelochemical activity of plant growth promoting rhizobacteria (PGPR). J. Chem. Ecol. 26:343-349
Bloemberg GV, Lugtenberg BJ (2001) Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Current Opinion Plant Biology. 4:343-350
Brown ME. (1974) Seed and root bacterization. Annual Review of Phytopathology 12: 181-197.
Cattelan AJ, Hartel PG, Fuhrmann JJ (1999) Screening for plant growth promoting rhizobacteria to promote early soybean growth. Soil Science Society of American Journal 63:1670- 1680
Chambers CE, Meintrye DD, Mouckn M, Solok PA (1996) Physical and structural characterization of yersiniophore, a siderophore produced by clinical isolate of Yersinia enterolitica. Biometal 19:7-16
Colyer PD, Mount MS (1984) Bacterization of potatoes with Pseudomonas putida and its influence on post harvest soft rot diseases. Plant Disease 68:703-706
Davies P. (1995) The plant hormone concept: concentration, sensitivity, and transport. In: hormones: physiology, biochemistry, and molecular biology, ed. by Davies, P., pp. 13-18. Plant Kluwer Academic Publishers, Dordrecht,
Defago G, Haas D (1990) Pseudomonads as antagonists of soil borne plant pathogens: mode of action and genetic analysis. Soil Biochem. 6:249-291.
Dye DW (1968) A taxonomic study of the genus Erwinia. I. the "amylovora" group. New Zealand J. Sci. 11:590-607
Gardner JM, Chandler L, Feldman AW (1984) Growth promotion and inhibition by antibiotics producing fluorescent Pseudomonads on citrus root. Plant Soil 77:103-113
Gerhardson B (2002) Biological substitutes for pesticides. Trends in Biotechnology 20:338-343
Guo Y, Zheng H, Yang Y. Wang H (2007) Characterization of Pseudomonas corrugata strain P94 isolated from soil in Beijing as a potential biocontrol agent. Curr Microbiol 55:247-253
Hofte M, Boelens J, Verstraete, W (1992) Survival and root colonization of mutants of plant growth promoting pseudomonads affected in siderophore biosynthesis or regulation of siderophore production. J. Plant Nutr. 15:2253- 2262.
James DW, Gutterson NI (1986) Multiple antibiotics produced by Pseudomonas fluorescens HV37a and their differential regulation by glucose. Applied and Environmental Microbiology 52:1183-1189
Johri BN, Rao CV. S, Goel R (1997) Fluorescent Pseudomonads in plant disease management. In: Biotechnological approaches in soil microrganism for sustainable crop production, Ed. by K. R. Dadarwal and Jodhpur, pp. 193-221. India: Scientific Publishers
Joseph B, Ranjan Patra R, Lawrence R (2007) Characterization of plant growth promoting rhizobacteria associated with chickpea (Cicer arietinum L.). International Journal of Plant Production. 1:141-151
Keel C, Schnider U, Maurhofer M, Voisard C, Laville J, Burger U, Wirthner P, Haas D. and Defago G (1992) Suppression of root diseases by Pseudomonas fluorescens CHAO: importance of bacterial secondary metabolite, 2,4- diacetylphoroglucinol. Mol. Plant-Microbe Interact. 5:4-13
Keel C, Voisard C, Berling CH, Kadr G, Defago G (1989) Iron sufficiency, a prerequisite for the suppression of tobacco root rot by Pseudomonas fluorescens strain CHAO under gnotobiotic conditions. Phytopathology 79:584-589
King EO, Ward MK, Raney DE (1954) Two simple media for the demonstration of pyocyanin and fluorescin. 1. Lab. Clin. Med. 44:301-307
Klement Z (1963) Rapid detection of the pathogenicity of phytopathogenic pseudomonads. Nature 199:299-300
Kloepper JW, Leong J, Teintze M, Schroth MN (1980) Enhanced plant growth by siderophores produced by plant growth promoting rhizobacteria. Nature 268:885-886
Kovacs N (1956) Identification of Pseudomonas pyocyanea by the oxidase reaction. Nature 178: 703
Kraus J, Loper JE (1992) Lack of evidence for a role of antifungal metaoolite production by Pseudomonas fluorescense PF5 in biological control of Pythium dampingoff of cucumber. Phytopathology 82:264-271
Lifshitz R, Kloepper JW, Kozlowski M, Simonson C, Carlson J, Tipping EN, Zaleska I (1987) Growth promotion of canola (rapeseed) seedlings by a strain of Pseudomonas putida under gnotobiotic conditions. Can. J. Microbiol. 8:102-106
Loper JE, Buyer JS (1991) Siderophore in microbial interactions on plant surfaces. Mol. Plant-Microbe Interact. 4:5-13
Loper JE, Henkels MD (1997) Availability of iron to Pseudomonas fluorescence in rhizosphere and bulk soil evaluated with an ice nucleation reporter gene. Appl. Environ. Microbiol. 63:99-105
Loper JE, Scroth MN (1986) Influence of bacterial sources on indole-3 acetic acid on root elongation of sugarbeet. Phytopathology 76:386-389
Lorck H (1948) Production of hydrocyanic acid by bacteria. Physiol. Plant. 1:142-146
Lugtenberg BJJ, Dekkers LC (1999) What makes Pseudomonas bacteria rhizosphere competent? Environ. Microbiol. 1:9-13
Meyer JM, Abdallah MA (1978) The fluorescent pigment of Pseudomonas fluorescens: biosynthesis, purification and physicochemical properties. J. Gen. Microbiol. 107:319-328
Miller JH (1974) Experiments in Molecular Genetics, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press
Mitchell JK, Carter WE (2000) Modeling antimicrobial activity of Clorox(TM) using an agar-diffusion test: a new twist on an old experiment. Bioscenece 26:9-13
Moeinzadeh A, Sharif-Zadeh F, Ahmadzadeh M, Heidari Tajabadi F (2010) Biopriming of sunflower (Helianthus annuus L.) seed with Pseudomonas fluorescens for improvement of seed invigoration and seedling growth. Australian Journal of Crop Science. 4:564-570.
Neiland JB, (1995) Siderophore: structure and function of microbial iron transport compounds. J. Biol. Chem. 270:26723-26726
Ojiambo PS, Scherm H (2006) Biological control and application-oriented factors influencing plant disease suppression by biological control: A meta-analytical review. Phytopathology 96:1168-74
O'Sullivan DJ, O'Gara F (1992) Traits of fluorescent Pseudomonas spp. involved in suppression of plant root pathogens. Microbiol. Rev. 56:662-676
Patten C, Glick B (1996) Bacterial biosynthesis of indole-3- acetic acid. Can. J. Microbiol. 42: 207-220
Patten C, Glick B (2002) Role of Pseudomonas putida indole acetic acid in development of the host plant root system. Appl. Environ. Microbiol. 68:3795-3801
Pierson EA Weller DM (1994) Use of mixtures of fluorescent Pseudomonads to suppress take-all and improve the growth of wheat. Phytopathology 84:940-947
Pikovskaya, RI (1948) Mobilization of phosphorous in soil in connection with vital activity of some microbial species. Mikrobiologiya 17:363-370.
Rangajaran S, Saleena L M, Vasudevan P, Nair S (2003) Biological suppression of rice diseases by Pseudomonas spp. under saline soil conditions. Plant Soil 251:73-82
Sambrook J, Fritsch FE, Maniatis TA (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Schaad NW, Jones JB, Chun W (2001) Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. APS Press, MN, 373 pp
Shaad NW, Jones JB, Chun W (2001) Laboratory guide for identification of plant pathogenic bacteria. Third edition. APS press, MN
Schippers B, Bakker AW, Bakker PAHM (1987) Interactions of deleterious and beneficial rhizosphere microorganisms and the effect of cropping practices. Annual Review of Phytopathology 25:339-358
Smibert RM, Krieg NR (1994) Phenotypic characterization. In: Methods for General and Molecular Biology, ed. by P.R.G. Gerhardt, E. Murray, W.A. Wood, and N.R. Krieg, pp. 607- 654. Washington, DC: American Society for Microbiology
Sunish Kumar R, Ayyadurai N, Pandiaraja P, Reddy AV, Venkateswarlu Y, Prakash O, Sakthivel N (2005) Characterization of antifungal metabolite produced by a new strain Pseudomonas aeruginosa PUPa3 that exhibits broadspectrum antifungal activity andvbiofertilizing traits. Journal of Applied Microbiology 98:145-154
Thornley Ml (1960) The differentiation of Pseudomonas from other Gram negative bacteria on the basis of arginine metabolism. Appl. Bacteriol. 1:37-52
Villacieros M, Power B, Sanchez-Contreras M, Loret J, Oruzebal RI, Martin M, Franandez-Pinas F, Bouile I, Whelan C, Dowling DN, Rivilla R (2003) Colonization behaviour of Pseudomonas fluorescens and Sinorhizobium meloti in the alfalfa (Medicago sativa) rhizosphere. Plant Soil 251:47-54
Wang C, Ramette A, Punjasamarnwong P, Zala M, Natsch A, Moenne-Loccoz Y, Defago G (2001) Cosmopolitan distribution of phlD-containing dicotyledonous cropassociated biocontrol pseudomonads of worldwide origin. FEMS Microbiology Ecology 37:105-116
Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S Ribosomal DNA Amplification for Phylogenetic Study. Journal of Bacteriology 173:697-703
Welbaum G, Sturz AV, Dong Z, Nowak J (2004) Fertilizing soil microorganisms to improve productivity of agroecosystems. Critical Reviews in Plant Sciences 23:175- 193
Weller DM (1988) Biological control of soil borne plant pathogens in the rhizosphere with bacteria. Ann. Rev. Phytopathol. 26:379-407.
Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S Ribosomal DNA Amplification for Phylogenetic Study. Journal of bacteriology 173:697-703.
Yuen GY, Schroth MN (1986) Interaction of Pseudomonads fluorescens strains E6 with ornamental plants and its effect on the composition of root colonization microflora. Phytopathology 76:176-179.
[Author Affiliation]
M. Maleki*1, S. Mostafaee1, L. Mokhtarnejad2 & M. Farzaneh2
1Department of plant protection, Islamic Azad University of Varamin-Pishva, Varamin, Iran
2Department of plant protection, University of Tehran, Iran
*Corresponding author: mojdehmaleki@iauvaramin.ac.ir
Комментариев нет:
Отправить комментарий