An Alabama evangelist who authorities say terrorized his family while preaching at revivals has been sentenced to life plus 51 years in prison after being convicted of killing his wife and storing her body in a home freezer.
Circuit Judge John Lockett imposed the sentence Thursday on Anthony Hopkins.
Assistant District Attorney Ashley Rich called Hopkins "evil of …
Oldies music was playing at the Lincoln Park bar and a circle ofco-workers danced.
But Lacey Hindman said she had no idea David Prange was about tograb her by the forearms and flip her into the air, jitterbug-style.
The small-framed 22-year-old said she was surprised as the stocky-built Prange tossed her airborne and she crashed headfirst into thewood floor at Stanley's Kitchen and Tap.
Hindman suffered a fractured skull and brain injuries in theApril 2006 incident and is now suing Prange -- whose wife, Kate, isa well-known fashion designer who owns the Shop Girl store whereHindman worked.
Hindman, of Chicago, wants unspecified damages for …
CABO SAN LUCAS, Mexico (AP) — Mexican authorities have sighted the wreckage of a small plane believed to have taken off from Los Angeles, California with four people on board.
The wreckage has been found in the mountains of Baja California near its apparent destination, the resort of Cabo San Lucas.
City civil defense director Francisco Cota Marquez says rescuers have …
Cardew, Cornelius, English composer of extreme avant-garde tendencies; b. Winchcombe, Gloucester, May 7, 1936; d. in a road accident in London, Dec. 13, 1981. He studied composition with Ferguson at the Royal Academy of Music in London (1953–57); in 1957 he went to Cologne and worked at the electronic studio there as an assistant to Stockhausen (1958–60). Returning to England, he organized concerts of experimental music. From 1963 to 1965 he had private lessons with Petrassi in Rome. In 1967 he was appointed to the faculty of the Royal Academy of Music in London. In 1969, together with Michael Parsons and Howard Skempton, he organized the Scratch Orch., a …
Cirque du Soleil to benefit Multi-Cultural Dance Center
Dance Drama! - Homer Bryant's Chicago Multi-Cultural Dance Center takes the magic of dance to new heights at Corteo, the latest world-class dance production by the internationally acclaimed ballet troupe, Cirque du Soleil, on July 28, 8 p.m., under the Grand Chapiteau tent in United Center's parking lot K. Proceeds of "Summer Solstice: Shaping the Future of Dance," a fund-raiser, will benefit scholarship programs for CMCDC students.
CMCDC and Cirque du Soleil celebrate Cirque's highly anticipated return to Chicago after a three-year absence. Benefit tickets are $100 each; and business and corporate sponsorship packages …
HARTFORD, Conn. - The man accused in the disappearance of a teenager found locked in a storage room in his home pleaded not guilty to several charges Tuesday, and his attorney said he was told additional charges were being filed.
Adam Gault entered his pleas to charges of second-degree unlawful restraint, second-degree reckless endangerment, second-degree custodial interference, interfering with a police officer, risk of injury to a minor and three counts of second-degree forgery.
Gault also was advised that he is being charged with "sexual assault of some nature," said his lawyer, Gerald Klein. The lawyer said he did not yet know the exact charges.
There was no …
The Pentagon chief is praising Pacific Rim nations as a model for anti-piracy crackdowns off the Horn of Africa.
U.S. Defense Secretary Robert Gates cited piracy on Monday as just one of the security issues facing the Asian region.
But he says partnered efforts by Indonesia, Malaysia, Thailand, and Singapore to combat piracy off the Malacca Strait have been …
The film "Izkor: Slaves to Memory" focuses on a month of Jewishcommemorations, beginning with Passover, through Holocaust and ArmyMemorial days and Independence Day.
Filmmaker Eyal Syvan tried to build the controversial case that,in Israel, commemoration of the Holocaust is used to nurture afearful, obedient and militaristic society. He believes that thelessons should be applied to building a liberal, just nation.
Syvan, 26, a self-described Israeli exile living in Paris, basedhis theme on the thoughts of Yeshayahu Leibowitz, a respectedpolitical theorist.
Leibowitz criticizes Israeli history teaching for its focus onpersecution. By presenting Jews …
SPA, Belgium (AP) — Red Bull's Mark Webber made the most of the conditions to post the fastest time before heavy rain returned to mar the second practice for the Belgian Grand Prix on Friday.
The Australian clocked 1 minute, 50.321 seconds, with Ferrari's Fernando Alonso second quickest in 1:50.461, and McLaren's Jenson Button third in 1:50.770.
Heavy rain affected the morning's first practice, and, although the conditions were much improved, another big downpour arrived nearly one hour into the second session.
Webber did not draw too many conclusions from his weather-affected performance.
"We got some dry running in, but only around four laps, two laps on the soft …
Scoreboard at stumps Sunday on the opening day of the third test between South Africa and England at Newlands Stadium:
South Africa 1st Innings
Ashwell Prince c Prior b Anderson 0
Graeme Smith c Prior b Anderson 30
Hashim Amla lbw b Onions 14
Jacques Kallis not out 108
A.B. de Villiers c Strauss b Swann 36
J.P. Duminy c Prior b Swann 0
Mark Boucher lbw b Broad 51
Dale Steyn not out 26
Extras: (1b, 11lb, 1w, 1nb) 14
…
Calling it the "urban Mt. Everest," French climber Alain Robertscaled the Sears Tower with his bare hands this morning, complainingonly that the top of the structure was slippery "because of theclouds."
Robert, 37, was arrested on the roof by Chicago police andcharged with criminal trespassing and failure to use a safety netwhile conducting an aerial show, both misdemeanors.
He was released after posting $100 against a $1,000 bond.
Among the more than 30 structures Robert has scaled are the EmpireState Building and the Eiffel Tower, as well as one of the PetronisTowers in Malaysia, which recently unseated the Sears Tower as theworld's tallest building. Sears, …
PIEDMONT, Okla. (AP) — When three tornadoes marched toward Oklahoma City and its suburbs, thousands of people in the path benefited from good forecasts, luck and live television to avoid the kind of catastrophe that befell Tuscaloosa, Ala., and Joplin, Mo.
Although at least 15 people died in the latest round of violent weather that started Tuesday, schools and offices closed early, giving many families plenty of time to take shelter. And even stragglers were able to get to safety at the last minute because TV forecasters narrated the twisters' every turn.
"We live in Oklahoma and we don't mess around," Lori Jenkins of Guthrie said after emerging from a neighbor's storm shelter …
Joe Pavelski and Milan Michalek each scored goals, Evgeni Nabokov made 26 saves and the San Jose Sharks beat the Nashville Predators 2-1 Tuesday night for their franchise-record 10th straight win.
The first goal was decided after a lengthy video review in the second period. On the power play, Jonathan Cheechoo was skating close in on the left side when he passed the puck to Pavelski in front of the net, pulling Dan Ellis out of position. Pavelski and Nashville's Greg Zanon got tangled in front of the net but Pavelski was able to get off a shot from close range. It looked like Zanon, who was lying down in the net behind the goal line, had stopped the puck.
The review ruled the puck had crossed the goal line.
Jason Arnott scored his 25th goal for Nashville.
Thirty-seven seconds into the third period the Sharks extended the lead to 2-0. Michalek skated past Greg de Vries and shot the puck between the leg pads of Ellis from close range.
Ellis made 40 saves.
The Predators ended Nabokov's shutout bid at 5:29 of the third period. Jason Arnott took a shot on the power play from the left circle that went high over the shoulder and outstretched glove of Nabokov.
Nabokov leads the NHL with 40 wins. He won all four games against the Predators this season.
Notes:@ Coach Barry Trotz was behind the bench for his 727th game with the Predators, moving him into 11th place all-time in games coached for one NHL team. He passed former Boston Bruins coach Milt Schmidt. David Legwand missed his second game in a row for the Predators due to a deep bone bruise of his left foot. The Sharks swept the series with the Predators 4-0 this season.
(This version CORRECTS Sharks 2, Predators 1. SUBS 8th graf to correct Nabokov's wins to 40 sted 31)
Angelica Brothers Electrical Contracting began as a pair of electricians in 1994, and has since become a pioneer of integrated contracting - offering everything from lighting to lightning-fast fiber optic cabling. The company's efforts to diversify its products and services have led to strong, consistent growth.
Jacks-of-afl-trades? Sure. But masters of none? Not likely.
John and Michael Angelica, founders of Angelica Brothers Electrical Contracting in Holyoke have heard all of the cliches as their electrical and telecom business grows and expands each year. They've been called everything from a one-stop shop to a technical catchall, and the terms don't faze them, as long as they get the last word.
"We're the one-stop shop, but we're also the real deal," said Michael.
Offering 'integrated service' in the areas of electrical contracting, telecommunications, and custom network services, Angelica Brothers - led by John and Michael and Telecommunications Division manager Bob Liswell - has seen exponential growth in recent years due to its all-inclusive, startto-finish approach to its three main offerings. With a client base that includes companies, municipalities, and individual homeowners, the first obstacle Angelica Brothers had to avoid was perception that the company might be stretching its expertise too thin.
Thus, the three men heading up the company have invested in extensive training, with the result being a workforce with diverse skill sets. And as the company's services continue to gain attention, those investments arc paying off, in the form of new and renewed contracts, strong customer feedback, and consistent new busi0 ness brought on by a string of referrals.
Angelica Brothers relocated from Monson to the former Reynolds Paper building on Main Street in Holyoke two years ago. Since then, the Angelicas and Liswell have noticed the advantages of doing business in an area with affordable real estate, just seconds away from the area's major highways. In response, they are focusing on building a reputation as a company that can help both individual enterprises and the overall economy through their services.
"Our options are cost-effective," said John Angelica. "We do the job from start to finish and we help people minimize their costs in many ways ... maybe we help them shut utilities off at peak times or look at monitoring options for their company. All of that plays into making money for everyone."
This month, BusinessWest looks at the short- and long-term forecast for Angelica Brothers, and how the company's approach to a fast-changing field has helped create an evergrowing client list.
Hot-wired
The principals at Angelica Brothers look at the evolution of their business as a natural progression in keeping with the technological advances of their craft.
"We're constantly reading up on the latest trends," John said, "so we can communicate them to the customer. Many companies would choose to focus on just one specialty, but we decided to focus on it all. Customers are always looking for ways to cut costs and make things more convenient. When we bring everything to the table, we're doing that for them."
John and Michael Angelica entered the electrical trade together in the late '80s, and started their own business in 1994. As demand for additional services grew, the brothers responded accordingly with new offerings such as design-build projects, utility construction, and lightning and surge protection.
Soon, that demand necessitated a new division within the company focusing on telecommunications. Liswell came on board in 2001 to head up the division, and helped the company gain speed in a myriad of telecom offerings, from fiber optics to voice, data, and video systems, and network installation.
Eventually, the two divisions began to intersect, creating a niche that set Angelica Brothers apart from other electrical contractors and telecom companies in the area; when a client requires both electrical wiring and data cables installed, that client has a choice of hiring two contractors to finish the job, or just one, because Angelica Brothers can handle all aspects of a project.
The wide range of services provided by Angelica Brothers has enabled the company to develop a large, diverse client base. Among its customers are the cities of Springfield and Holyoke, Westover Air Reserve Base, and Verizon. The company has also branched out across New England and New York.
"We've become an integrated contractor," Liswell said. "And therefore we can offer integrated solutions."
In keeping with that model, the company is now concentrating more on the third-tier of its business plan - the design and installation of customized network systems and 'lifestyle enhancements' which serves as a bridge between the electrical and telecommunications components.
Angelica Brothers markets the custom systems to both individuals and businesses, and offers Internet access and networking, multi-room video and stereo audio, and monitoring and lighting control systems, among other products and services. Once reserve consumers with plentv of cash to burn, customized home network systems are becoming more mainstream, said the brothers Angelica, and their company is poised to capitalize on that phenomenon.
"We think there's a market there that not a lot of people are paying attention to," John said, adding that the company paid to have all of its employees trained by Leviton Integrated Networks, one custom system provider Angelica Brothers works with, in order to offer a lifetime warranty to businesses and homeowners. The business gained further recognition when it became the only custom installation contractor for Yamaha in Western Mass.
"We made the investment to offer this service, and now we can build to people's needs, so things like surround-sound or monitoring systems become something they can afford. We can take different avenues, and not just offer the $100,000 systems."
The custom systems now comprise approximately 20% of Angelica Brothers' business, after only a few years on the company's formal list of products and services. They were put on display at the Western Mass. Home Show, said Liswell, noting that most of the visitors to the company's booth were typical homeowners, and the booth was crammed with people each day of the show.
As part of a large family, John and Michael Angelica said they grew up in a middle-class family and are excited about their company's ability to bring quality-of-life products to, as they put it, "the people that make it all happen."
"Everybody should be able to have this technology," said Michael. "And there are different levels now; we don't have to sell people 100 things - we can sell them two. A customer can get surround-sound in their whole house, or get it in just one room. They can get a black-and-white monitoring system, or one in color."
End of the Line
The wide gamut of choices that Angelica Brothers promotes is one reason for its success; community-minded business practices are another. Old-fashioned elbow grease never hurts, though, and hasn't gone unnoticed in this case.
"Whatever it takes, we'll get it done," John said. "We're three guys in our 30s and we plan on being here for a while. We want to work with people and do the best job; we can't do work that will make someone never want to see us again."
Their company was recently honored by the Holyoke Chamber of Commerce for their work with the Holyoke Street School, at which the company donated and installed all of the insidecabling needed for the school to access the Internet at all of its computer stations.
The night before the chamber breakfast at which Liswell and the Angelica brothers were to be recognized, they worked through the night to repair Holyoke Community College's fiberoptic system, which had been damaged, knocking out Internet service campus-wide at the peak of the spring semester.
Bleary-eyed, the trio was welcomed at the early morning event with a standing ovation.
ATHENS, Greece (AP) — Greek authorities say an earthquake with preliminary magnitude of 5.1 has struck the north of the country. No injuries or damage were immediately reported.
The Athens Geodynamic Institute says the undersea earthquake occurred at 3:34 a.m. Tuesday 151 miles (243 kilometers) north of the Greek capital, Athens, off the coast of the northern peninsula of the Athos monastic community. The United States Geological Survey gave the preliminary magnitude as 5.3. It is common for magnitudes given by different seismological centers to vary.
Greece is in one of the world's seismically active areas, with hundreds of quakes occurring each year. The vast majority cause no injuries
Elaine Sherman ignited the culinary scene in Chicago with the sameenthusiasm Julia Child displayed revolutionizing the nation's cookingand eating tastes.
Ms. Sherman showed people how to be great cooks, helped them findcutting-edge ingredients and professional cookware, and promotedchocolate of the finest quality and in every imaginable form untilher colleagues dubbed her Madame Chocolate.
Ms. Sherman, a resident of Northbrook, died Friday at EvanstonHospital after a long illness. She was 63.
She was born Aug. 1, 1938, in Chicago, the daughter of Arthur andSylvia Friedman, and attended Northwestern University.
When her first marriage fell apart she was left with threechildren to support. Always a great cook, she studied at Dumas Pere,L'Ecole de la cuisine francaise and taught cooking for continuingeducation courses and in people's homes.
"She really ignited the whole food movement in Chicago," formerChicago Sun-Times food editor Bev Bennett said.
She opened one of the region's first gourmet cookware stores, rana chocolate warehouse, wrote a cookbook and did free-lance foodwriting including for the Sun-Times, and constantly promoted greatfood.
"She was very generous. She would always call up and say, 'Bev,you have to try so and so's such and such.' A, she would be right,and B, she was promoting someone else, not herself," Bennett said.
When young Bob Piron started his Belgian Chocolatier business inthe mid 1980s, she bought and sent boxes of his chocolates to keyfood writers and industry members to introduce him.
"It was absolutely selfless help. If she liked your product or sheliked you, without any personal gain she would introduce you to theright people, she would give you marketing ideas, she would put youtogether with other people so you could brainstorm. I've never metanyone quite like her," Piron said.
Many people knew her through the chocolate weekends she organizedhere and in Las Vegas.
Ms. Sherman discovered that her students didn't have the equipmentneeded for great cooking, not even a whisk. She talked a wholesalerinto letting her buy one piece of equipment at a time and became oneof his biggest customers as she resold great pots, pans and gadgetsto her students.
She teamed up with Wilma Sugarman in 1976 to open The CompleteCook store. They offered cooking classes featuring some of the greatnames on the American culinary scene. Even the great James Beardtaught a class there.
In the early 1980s, Ms. Sherman began selling gourmet importedchocolate for baking and candymaking by mail order. It was the firsttime many home bakers had access to some of the great chocolate ofEurope.
Her 1984 cookbook, Madame Chocolate's Book of Divine Indulgences,is a classic compendium of great chocolate-based desserts and sweets.
A warehouse fire eventually put her out of the chocolate business.She became director of marketing for airline caterer Sue Ling Gin,then became a consultant on food management and marketing.
She married Jerry Spiegel in 1989.
Survivors in addition to her husband are two sons, Steven andDavid; a daughter, Jaime Touras; a stepdaughter, Sharon Cohen; astepson, Alan Spiegel; a brother, Stanley Friedman, and sevengrandchildren.
Services were Monday at Weinstein Family Services Wilmette Chapelwith burial in Westlawn Cemetery, Chicago.
HARARE, Zimbabwe (AP) — An independent Zimbabwe newspaper says three government ministers from the smallest group in Zimbabwe's troubled coalition have been briefly detained.
The Daily News said Monday the three were briefly held Sunday in the northeastern city of Hwange after being stopped at a police road block. It was unclear what the charges were.
Those arrested included Welshman Ncube, industry minister and leader of a party that split from Prime Minister Morgan Tsvangirai's Movement for Democratic Change.
The party spokesperson and the police did not immediately respond to requests for comment.
Independent lawyers' groups have said since longtime ruler President Robert Mugabe called for elections this year, there has been an upsurge in violence and arbitrary arrests of his rivals.
PEARL, Miss. (AP) — Texas Gov. Rick Perry, who's running for president, is picking a fight with House Democratic leader Nancy Pelosi, who is not. Struggling to steady his bid for the GOP nomination, Perry this week launched an outsider's campaign against Washington culture and challenged Pelosi, ousted last year from the House speakership, to debate his plan to overhaul Congress.
She declined Thursday, becoming the latest congressional Democrat to mock Perry for the 54-second debate pause that launched a thousand jokes — some from Perry himself — during which the Texas governor couldn't recall the third of three government agencies he wants to eliminate.
"Monday I'm going to be in Portland in the morning. I'm going to be visiting some of our labs in California in the afternoon. That's two," Pelosi told reporters. "I can't remember what the third thing is I'm going to be doing."
Very funny, Perry suggested during a stop Jackson-Evers International Airport. Then he launched into Pelosi with a stream of accusations that echoed Republican attacks on her during the 2010 elections as the face of government overreach on health care, the economy and more.
"She may have forgotten all the reasons she can't debate me on overhauling Washington, D.C., but the American people sure haven't forgotten the reasons we need to overhaul Washington," Perry said. "When you have routine insider corruption on Capitol Hill, when you have liberal opposition for freeing the economy of this country, when you have just total disrespect for family values, I would suggest to you that's the reason Nancy Pelosi is running away from having a debate with me."
He never said so explicitly, but Perry apparently was referring to a report on CBS' "60 Minutes" that looked at the investments of members of Congress, including Pelosi, House Speaker John Boehner and others, who reportedly bought stocks around the same time related legislation was being discussed. Pelosi and her husband participated in an initial public offering of Visa in 2008, buying 5,000 shares at the initial price of $44, the network reported; two days later, shares were trading at $64, CBS said.
A spokesman for Pelosi said her husband, Paul, sold a fraction of those stocks months later at the height of the financial crisis, when the price had again dropped. Those sales generated a profit of less than $5,000, said Pelosi aide Drew Hammill.
As for the debate dare, "It's unfortunate that a candidate for president is focused on debating anyone other than his primary opponents and repeating false claims," Hammill said late Thursday.
Pelosi was last year's political pinata. Republicans spent millions of dollars in the 2010 election branding Pelosi with President Barack Obama's unpopular health care overhaul — and it worked. The message appealed to the populist tea party movement, which coalesced around the idea of a smaller, more austere government and surged on anger over the Democratic-controlled government's involvement in economic stimulus, the bailout of the auto and financial industries and the health care law.
Voters a year ago flipped control of the House from Democratic to Republican, and in January, Pelosi relinquished the gavel to now-Speaker John Boehner.
Tea party groups instrumental in those midterm elections are gearing up for the 2012 presidential race — but this time, they're holding Boehner accountable. Pelosi, after all, has been vanquished, one leader of the movement said.
"People still have a very strong opinions about her, but I don't really hear people on the ground talking about her very much," said Jenny-Beth Martin, co-founder of a coalition of groups called Tea Party Patriots, who's most recently visited Ohio and Florida, two states both parties have a good chance of winning. "Her power has been diminished. People are more focused on Speaker Boehner and what the Republican House leadership is doing now."
But, she noted, people do associate Pelosi strongly with the health care overhaul. The Supreme Court is expected to hear arguments over the new law in the spring — right at the height of the presidential and congressional election year.
Perry charged ahead at Pelosi Thursday, even though a number of Republicans have also been accused of using information they gained by virtue of their office to trade investments.
"If you and I did that, we would be engaged in criminal activity," Perry said. He challenged Pelosi to turn over her financial records to the Securities and Exchange Commission or a special prosecutor to be examined for evidence of misconduct.
Members of Congress are required by law to make public their financial records every year.
The longtime Texas governor was investigated by the SEC himself in 1996 for a transaction where he bought 2,800 shares in Kinetic Concepts Inc., a company mostly owned by James Leininger, a big donor to Perry and other Texas Republicans. Perry went on to sell 8,000 shares a month later, making $38,000. He was accused of taking a stock tip from Leininger.
"The SEC looked at that and there wasn't anything to it," Perry said Thursday.
___
Amy reported from Mississippi. Kellman reported from Washington.
T
Paul Tagliabue -- TAG'-lee-uh-boo
So Taguchi -- soh tah-GOO'-chee
David Tanabe -- tuh-NAH'-bee
Hidemichi Tanaka -- hih-deh-MEE'-chee tah-NAH'-kah
Tamarine Tanasugarn -- TAM'-uh-rihn tahn-ah-SOO'-gahrn
Alex Tanguay -- TAN'-gay
Thomas Tapeh -- tuh-PAY'
Johnny Tapia -- TAH'-pee-uh
Fernando Tatis -- tah-TEES'
Lofa Tatupu -- LOH'-fuh tah-TOO'-poo
Diana Taurasi -- tohr-AH'-see
Ramonce Taylor -- ruh-MAHNS'
Junichi Tazawa -- joo-NEE'-chee tah-ZAH'-wah
Mark Teahan -- TEE'-ehn
Tim Tebow -- TEE'-boh
Mark Teixeira -- teh-SHEHR'-uh
Miguel Tejada -- mee-GEL' tay-HAH'-dah
Amaury Telemaco -- ah-MOHR'-ee teh-leh-MAH'-koh
Claude Terrell -- teh-REHL'
Rachel Teske -- TEHS'-kee
Hasheem Thabeet -- hah-SHEEM' thah-BEET'
Marcus Thames -- tihmz
Jose Theodore -- joh-SAY' THEE'-uh-dohr
Michel Therrien -- mih-SHEHL' TEHR'-ee-ihn
Reggie Theus -- THEE'-us
Adalius Thomas -- uh-DAY'-lihs
Etan Thomas -- eh-TAHN'
Jim Thome -- TOH'-mee
Luis Tiant -- LOO'-ee TEE'-ahnt
Kelly Tilghman -- TIL'-muhn
Kimmo Timonen -- KEE'-moh TEE'-moh-nehn
Iben Tinning -- EE'-bin
Janko Tipsarevic -- YAHN'-koh tihp-SAYR'-oh-vihch
Mike Tirico -- tih-REE'-koh
Rick Tocchet -- TAH'-keht
Jonathan Toews -- tayvz
Alimzhan Tokhtakhounov -- ah-LEEM'-zahn tohk-TAHK'-uh-nuhv
John Torchetti -- tohr-CHEH'-tee
Yorvit Torrealba -- yohr-VEET' tohr-ee-AL'-bah
Matteo Tosatto -- mah-TAY'-oh toh-SAH'-toh
Vesa Toskala -- VAY'-sah TAHS'-kah-lah
Tatiana Totmianina -- taht-YAH'nah toht-MYEH'-ni-nuh
Monte Towe -- tow
Steve Trachsel -- TRAK'-sihl
Mike Tranghese -- tran-GEE'-see
Matt Treanor -- TRAY'-nur
Misty May-Treanor -- TRAY'-nur
Yannick Tremblay -- YAH'-nik TRAHM'-blay
Marcus Trufant -- TROO'-fahnt
Jarno Trulli -- YAHR'-noh
Chin-hui Tsao -- chin-hwee sow
Yani Tseng -- YAH'-nee sehng
Jo-Wilfried Tsonga -- SAHNG'-guh
Marques Tuiasosopo -- too-ee-ah-suh-SOH'-poh
Troy Tulowitzki -- too-loh-WIT'-skee
Iroda Tulyaganova -- EE'-roh-dah too-lee-GAHN'-uh-vuh
Meilen Tu -- MAY'-lehn TOO
Jerame Tuman -- JEHR'-uh-mee TOO'-muhn
Dire Tune -- TOO'-nay
Mark Turgeon -- TUR'-jihn
Ronny Turiaf -- TOOR'-ee-af
Hedo Turkoglu -- HAY'-doo TURK'-oh-loo
Dmitry Tursunov -- duh-MEE'-tree tur-SIHN'-awf
David Tyree -- ty-REE'
U, V
Ayinde Ubaka -- ah-YIHN'-day oo-BAH'-kah
Kenechi Udeze -- keh-NEE'-chee yoo-DEH'-zee
Peter Ueberroth -- YOO'-bur-awth
Bob Uecker -- YOO'-kur
Momoko Ueda -- moh-MOH'-koh oo-AY'-duh
UEFA -- yoo-AY'-fuh
Yukiko Ueno -- yoo-KEE'-koh WAY'-noh
Bohdan Ulihrach -- BOH'-dan OO'-lee-rahk
Jan Ullrich -- yahn OOL'-rik
Osi Umenyiora -- OH'-see yoo-mihn-YOHR'-uh
Ugueth Urbina -- OO'-get ur-BEE'-nuh
Juan Uribe -- yoo-REE'-bay
Brian Urlacher -- UR'-lah-kur
Mario Urrutia -- yuh-ROO'-tee-uh
USAC -- YOO'-sak
Nicole Vaidisova -- vay-deh-SOH'-vuh
Ismael Valdes -- IHSH'-may-ehl
Jose Valentin -- VAL'-en-teen
Alejandro Valverde -- ah-leh-HAHN'-droh val-VEHR'-dee
Jose Valverde -- val-VAYR'-day
Butch van Breda Kolff -- BREH'-duh kawf
Pieter van den Hoogenband -- PEE'-tur van den HOH'-gen-bahnd
Mike Vanderjagt -- VAN'-dur-jakt
Kiki Vandeweghe -- KEE'-kee VAN'-duh-way
James vanRiemsdyk -- van-REEMZ'-dyk
Pete Van Wieren -- WEER'-uhn
Anderson Varejao -- VAR'-eh-zhoh
Semen Varlamov -- SEH'-min VAHR'-luh-mahv
Simeon Varlamov -- vahr-LAH'-mawf
Josef Vasicek -- VAH'-sih-chek
Greivis Vasquez -- GREE'-vihs
Dave Veres -- veerz
Antoine Vermette -- AN'-twahn vuhr-MEHT'
Elena Vesnina -- vehz-NEE'-nuh
Vezina -- VEH'-zih-nuh
Jose Vidro -- VEE'-droh
Alain Vigneault -- vihn-YOH'
Guillermo Vilas -- gee-EHR'-moh VEE'-lahs
Oscar Villarreal -- vihl-uh-ree-AHL'
Camilo Villegas -- kuh-MIHL'-oh vih-JAY'-guhs
Jacques Villeneuve -- zhahk VIHL'-ih-noov
Charlie Villenueva -- vihl-uh-noo-AY'-vuh
Ron Villone --vih-LOHN'
Fernando Vina -- VEEN'-yuh
Adam Vinatieri -- vihn-uh-TEHR'-ee
Roberta Vinci -- VIN'-chee
Andreas Vinciguerra -- vihn-see-GEHR'-ah
Adam Vinitieri -- vihn-uh-TEHR'-ee
Alexandre Vinokourov -- vihn-oh-KOHR'-awf
Vitaly Vishnevski -- vih-TAL'-ee vihzh-NEHV'-skee
Lubomir Visnovsky -- LOO'-boh-meer vihs-NAHF'-skee
Laura Viveros -- bee'-VEHR'-ohs
Nuria Llagostera Vives -- NOOR'-ee-ah yah-goh-STEHR'-ah VEE'-vehs
Jose Vizcaino -- viz-ky-EE'-noh
Luis Vizcaino -- viz-ky-EE'-noh
Thomas Voeckler -- VOHK'-lur
Tomas Vokoun -- TAH'-muhz voh-KOON'
Kimo von Oelhoffen -- KEE'-moh vahn OHL'-hawf-ihn
Jake Voskuhl -- VAHS'-kuhl
Joey Votto -- VAH'-toh
Mike Vrabel -- VRAY'-bul
Radim Vrbata -- rah-DEEM' vur-BAH'-tah
Sasha Vujacic -- VOO'-yah-chihch
Milos Vujanic -- voo-YAH'-nich
John Vukovich -- VOO'-kuh-vich
David Vyborny -- vih-BOHR'-nee
W, X, Y, Z
WADA -- WAH'-duh
Bob Waddell -- wah-DEHL'
Doug Waechter -- WEHK'-tur
Dajuan Wagner -- duh-WAHN'
Waipahu -- wy-PAH'-hoo
Don Wakamatsu -- wahk-ah-MAHT'-soo
Melaine Walker -- MEE'-layn
Wes Walz -- wahlz
Abby Wambach -- WAHM'-bahk
Chien-Ming Wang -- shee-EHN' ming wahng
Patricia Wartusch -- pah-TREET'-see-ah VAR'-toosh
Shani Waugh -- SHAY'-nee WAHR
Stanislas Wawrinka -- vah-VINK'-ah
Karrie Webb -- KAHR'-ee
Dave Wegrzyn -- WEH'-zihn
Roger Wehrli -- WUR'-lee
Yang Wei -- yahng way
D.A. Weibring -- WY'-bring
Todd Weiner -- WY'-nur
Mattias Weinhandl -- WYN'-han-dul
Chris Weinke -- WEN'-kee
Eric Weinrich -- WYN'-rihch
Mike Weir -- weer
Delonte West -- deh-LAHN'-tay
Brett Wetterich -- WET'-ur-ihk
Suzy Whaley -- WAY'-lee
Ken Whisenhunt -- WIHZ'-en-hunt
Kort Wickenheiser -- WIHK'-ihn-hy-zur
Charlie Wi -- wee
Michelle Wie -- WEE
Deron Williams -- DA'-rihn
Petteri Wirtanen -- PEH'-tur-ee WEER'-tah-nehn
Jay Witasick -- wih-TAS'-ihk
Doug Wojcik -- WOH'-chik
Wojtek Wolski -- VOY'-tehk VOHL'-skee
Tony Womack -- WOH'-mak
Chien-Ming Wong -- shee-EHN' ming wahng
Caroline Wozniacki -- wohz-nee-AK'-ee
Wrentham -- REN'-thum
Wykagyl Country Club -- WIHK'-uh-gihl
Shen Xue -- shen shway
Alexei Yashin -- YASH'-in
Carl Yastrzemski -- yah-STREM'-skee
Olga Yegorova -- yeh-guh-ROH'-vah
J.J. Yeley -- YAY'-lee
Stephane Yelle -- steh-FAHN' YEHL
Yi Jianlian -- EE JEE'-ahn-LEE'-ahn
Mikhail Youznhy -- mih-KAYL' YOOS'-nee
Steve Yzerman -- EYE'-zur-muhn
Mariano Zabaleta -- zah-bah-LAY'-tah
Erik Zabel -- ZAH'-bul
David Zabriske -- zah-BRIHS'-kee
Mariel Zagunis -- zuh-GOO'-nihs
Babe Zaharias -- zuh-HA'-ree-uhs
Klara Zakopalova -- (KLAH'-ruh za-kop-ah-LOH'-vuh)
Dave Zastudil -- ZAS'-too-dehl
Jack Zduriencik -- zur-EHN'-sihk
Tony Zendejas -- zehn-DAY'-hahs
Alex Zhamnov -- ZHAM'-nahf
Zheng Jie -- zhehng jee
Nikolai Zherdev -- NIHK'-oh-ly ZHEHR'-dehv
Marek Zidlicky -- zid-LICH'-kee
Barry Zito -- ZEE'-toh
Sergei Zubov -- ZOO'-bahv
Dainius Zubrus -- DAYN'-ee-uhs ZOO'-bruhs
Fabiola Zuluaga -- FAH'-bee-oh-lah zoo-loo-AH'-gah
Joel Zumaya -- zoo-MY'-uh
Vera Zvonareva -- zvahn-uh-RAY'-vuh
Abstract
Antagonistic rhizobacteria, more specifically fluorescent pseudomonads and certain species of Bacillus, are known to control of fungal root diseases of agronomic crops. In this study, 144 bacteria were isolated from cucumber rhizosphere and screened as potential biological control agents against Phytophthora drechsleri, causal agent of cucumber root rot, in vitro and greenhouse condition. On the basis of dual culture assays, eight isolates were selected for root colonization, PGPR and greenhouse studies. Among these isolates, isolate CV6 exhibited the highest colonization on the roots and significantly promoted plant growth under in vitro condition. In greenhouse studies mortality in pots treated with strain CV6 was very low and percent of healthy plants were 85.71%. Based on biochemical and physiologic tests and 16SrDNA homology, this isolate identified as Pseudomonas fluorescensstrain CV6. Strain CV6 was shown to have broad spectrum in vitro antibiotic activity against 11 additional plant pathogens. It was able to produce considerable amount of siderophore and acid indole-3-acetic acid (IAA). With the addition of tryptophan from 50 to 500 mg/ml the production of IAA was increased up to 15.3 �g/ml. The bacterium showed positive reactions for HCN, catalase, protease, and phosphatase, and negative for the production of pectinase, lipase and cellulase. Results from this study provide comprehensive information on nutritional requirements and biocontrol mechanisms of strain CV6 that can be used for commercial use and appropriate application of this bacterium.
Keywords: biological control, antagonists, PGPR, colonization, HCN, siderophore
(ProQuest: ... denotes formula omitted.)
Introduction
The rhizosphere, representing the thin layer of soil surrounding plant roots and the soil occupied by the roots, supports large active groups of bacteria (Villacieros et al., 2003) known as plant growth promoting rhizobacteria (PGPR) (Kloepper et al., 1980). Plant growth promoting rhizobacteria are known to rapidly colonize the rhizosphere and suppress soilborne pathogens at the root surface (Rangajaran et al., 2003). These organisms can also be beneficial to the plant by stimulating growth (Bloemberg and Lugtenberg, 2001; Moeinzadeh et al., 2010). Among these organisms, Fluorescent Pseudomonads are considered to be the most promising group of plant growthpromoting rhizobacteria involved in biocontrol of plant diseases (Gardner et al., 1984; Moeinzadeh et al., 2010). They produce secondary metabolites such as antibiotics (Keel et al., 1992), phytohormones (Keel et al., 1992), volatile compound Hydrogen cyanide (HCN) (Defago and Haas 1990), and siderophores (Neiland, 1995). Plant growth-promoting ability of these bacteria is mainly because of the production of indole-3- acetic acid (IAA; Patten and Glick 2002), siderophores (Schippers et al., 1987) and antibiotics (Colyer and Mount 1984). Production of antibiotics such as phenazine-1-carboxylic acid (PCA), pyocyanin, 2-acetamidophenol, pyrrolnitrin, pyoluteorin, Phenazine-1-Carboxylic Acid, 2,4-diacetylphloroglucinol, viscosinamide and tensin in different species of pseudomonads has been reported (Sunish Kumar et al., 2005). Production of siderophores has also been linked to the diseasesuppressing ability of certain fluorescent Pseudomonas species (Loper and Buyer, 1991). The control of phytophthora root rot of soybean (Lifshitz et al., 1987), tobacco black root rot (Keel et al., 1989), fungal diseases of orange, lemon citrus roots (Gardner et al., 1984), and ornamental plants (Yuen and Schorth, 1986) has been demonstrated with fluorescent Pseudomonads. In the present study, a soil isolate CV6, identified according to chemotaxonomic characterizations as well as 16S rDNA gene sequence analysis. The possible growth-promoting and biocontrol potential of the aforementioned strain has been investigated by determining the secondary metabolites, viz. IAA, siderophore, and HCN production.
Material and methods
Microbial cultures and media
Fluorescent pseudomonad strains, Pseudomonas fluorescens PF5, P. fluorescens CHA0, P. fluorescens 2-79, and P. aeruginosa 7NSK2, and plant pathogenic fungal strains, were obtained from the collection of microbial culture (Department of Plant Protection, University of Tehran, Karaj, Iran). Stock cultures of bacteria were prepared for storage at -80�C in 1.5 ml vials by mixing equal volumes of 50 % glycerol and 24-h culture broth [from single colony inoculum, 25ml LB medium, 100ml flask, 130 rpm]. Fungal strains after growth on slants of potato dextrose agar (PDA) were maintained under liquid paraffin.
Isolation and screening of fluorescent bacteria
In April 2009, a total of 50 cucumber plants were collected from fields and greenhouses of Varamin, Tehran province of Iran. Roots gently removed from soil and placed in plastic bags before they were transported to the laboratory. Adhering soil was carefully brushed off the plant roots, followed by gentle washing of the roots in sterile water. One gram of roots was placed in 9 ml of 0.1 M phosphate buffer (pH 7) supplemented with 0.025% Tween 20 and vortexed for 5 min. Then, 100 �l of first to forth diluents transferred to Gould's S1 medium (CA) plates and incubated at 27 �C for 2 days. Single colonies that fluoresced under UV light (366 nm) were selected and further cultured to establish pure cultures. The in vitro inhibition of mycelial growth of Ph. drechsleri by isolates was tested by using the dual culture technique as described by Ahmed Idris et al., (2007). Volatile compounds produced by bacteria were detected in a split plate experiment (Kraus and loper 1992). The isolates, which showed antagonistic activity in the dual culture and split plate assays, were tested for their ability to promotion of plant growth and colonize the roots by using the methods describe by Ahmadzadeh and Shrifi-Tehrani (2009). The ability of isolates to suppress Phytophthora damping-off of cucumber in greenhouse was examined on Cucumis sativus L. Soltan cultivar. Seven surface sterilized (2.5% NaOCl, 3 min) seeds of Soltan cultivar seeded in polyethylene pots (8 cm in diameter) filled with a 1:1:2 mixture of peat, sand and soil from Varamin, Iran. Then, the pots were transferred to the greenhouse (16 h of light and 25-27�C) watered at a three-day interval and kept for 10 days. Ten days after seeding, pots were topped up with 30 g of the potting mix that had been blended with white bean seed inoculum of Ph. drechsleri and drenched with 20 ml of bacterial suspensions or a solution of 1 g L-1 Ridomil MZ-72 WP. Then pots were watered and arranged in a randomized complete block design and incubated in mentioned condition. The treatments in this experiment were: Pots inoculation with Ph. drechsleri and bacteria, inoculation with Ph. drechsleri and mix of bacterial strains, inoculation with Ph. drechsleri and Ridomil, inoculation only with Ph. drechsleri but no bacteria (CI) and control without inoculation (C). There were four pots for each treatment. After 2 and 3 weeks, percentage of the healthy plants was determined. After last assessment of disease severity, plants were removed from pots and fresh and dry weight parameters of them were measured.
Identification of strain CV6, on the basis of biochemical and physiological characterization
Strain CV6 was identified on the basis of tests for cytochrome oxidase (Kovacs, 1956), arginine dihydrolase (Thornley, 1960), gelatin liquefaction (Dye, 1968), production of diffusible nonfluorescent pigment (pyocyanin) on King's A medium (King et al., 1954), tobacco HR (Klement, 1963), nitrate reduction, growth at 4 and 41�C, levan production, (Shaad et al., 2001) and the ability to growth on carbon sources such as Larabinose, D-galactose, trehalose, meso-inositol, sorbitol, Ltartrate was tested with the basal medium of Ayers et al., (1919).
16S rDNA gene sequencing
Genomic DNA of CV6 was extracted and purified according to the method described by Wang et al., (2001). 16S rDNA was amplified from CV6 genomic DNA with the primers PS16f 5?TGGCTCAGATTGAACGCTGGCGG-3?and PS16r5?- GATCCAGCCGCAGGTTCCCCT AC -3?. PCR amplification was carried out in 20 �l reaction mixtures containing 4 �l of lysed bacterial suspension, 1� PCR bovine serum albumin, 5% dimethyl sulfoxide, 100 �M each of dATP, dCTP, dGTP and dTTP, 0.40 �M of each primer and 1.4 U of Taq DNA polymerase Amplifications were performed with a Corpet research g001 cycler. The initial denaturation (2 min at 94 �C) was followed by 30 PCR cycles (94 �C for 30 s, 60 �C for 30 s and 72 �C for 60 s) and a final extension at 72 �C for 10 min. The amplified DNA was purified using polymerase chain reaction (PCR) purification kit (Promega, Madison, WI, USA), diluted to 200 ng �1-1, and was sequenced at Microsynth Inc. (Balgach, Switzerland).
Assessment of antiphytopathogenic activity against several phytopathogens
The antagonistic ability of P. fluorescens CV6 was checked against 12 phytopathogenic fungi, according the method described by Ahmed Idris et al., (2007) Three 10 �l drops from the 108 cfu/ ml suspension were equidistantly placed on the margins of potato dextrose agar (PDA) plates and incubated at 28 �C for 24 h. A 6 mm agar disc from fresh cultures of Ph. drechsleri was placed at the centre of the PDA plate for each bacterial isolate and incubated at 27 � 1 �C for seven days. The radii of the fungal colony towards and away from the bacterial colony were measured. The percentage growth inhibition was calculated using the following formula:
...
Where, r is the radius of the fungal colony opposite the bacterial colony and, R is the maximum radius of the fungal colony away from the bacterial colony. There were three replicate in this assay.
Detection and production of siderophore
The siderophore production was determined by Chrome Azurol S (CAS) assay (Alexander and Zuberer, 1991). Culture of test strain CV6 was grown in M9 minimal medium (Sambrook et al., 1989) at 27�C to a density of 108 CFU/ml. Cells in late log phase were removed by centrifugation at 3000 rpm, and the filtrate was tested for siderophore on CAS agar plates. Also, the quantitative estimation was performed according to the method of Chambers et al., (1996). Specific tests were carried out for quatification of pyoverdine according to the method of Meyer and Abdallah (1978). There were three replicate in this assay.
Assay for indole acetic acid (IAA) production
Quantitative analysis of IAA was performed using the method of Loper and Scroth (1986) at different concentrations of tryptophan (0, 50, 150, 300, 400 and 500 mg/ml). Bacterial cultures were grown for 48 h in nutrient broth (peptone, 5 g; yeast extract, 1.5 g; beef extract, 1.5 g; and NaCl, 5 g; each per liter).
Fully grown cultures were centrifuged at 3000 rpm for 30 min. The supernatant (2 ml) was mixed with two drops of orthophosphoric acid and 4ml of Salkowski reagent (50 ml, 35% of perchloric acid, 1 ml 0.5 M FeCl3 solution). Development of pink color indicates IAA production. Optical density was taken at 530 nm with a spectrophotometer (T70+ UV/VIS, PG instruments). Concentration of IAA produced by cultures was measured with the help of standard graph of IAA (Hi-media) obtained in the range of 10-100 mg/ml. There were three replicates in this experiment.
Assays for hydrolytic activity and detection of HCN
Cellulase and pectinase production by the strain was determined as described by Cattelan et al., (1999). M9 medium agar (Miller, 1974) amended with 10 g of cellulose and 1.2 g of yeast extract per liter of distilled water was used to test the cellulase activity, in which a clear halo after 8 days of incubation of the colonies at 28�C was considered as positive for cellulase production. For determining the pectinase activity, 10 g pectin plus 1.2 g yeast extract was amended in M9 medium agar and the plates were flooded with 2 M HCl after 2 days of incubation at 28�C. Clear halos around the colonies were considered as positive for pectinase production. Lipase medium was used to check the lipase production, which was indicated by clear zones surrounding the colonies (Smibert and Krieg 1994). Phosphatase activity was determined by development of a clear zone in Pikovskaya's agar medium after 2-5 days incubation of assay plates at 28�C (Pikovskaya 1948). Proteolytic activity was determined by using skimmed milk agar (pancreatic digest of casein 5 g, yeast extract 2.5 g, glucose 1 g, 7% skim milk solution 100 ml, agar 15 g dissolved in 1 l distilled water) (Sunish Kumar et al. 2005). After 2 days incubation at 28�C, a clear zone around the cells indicated positive proteolytic activity (Smibert and Krieg 1994). Production of HCN by CV6 on KB media with different concentrations of iron was observed according to the method of Lorck (1948). There were three replicates in all assays.
Results
Isolation and screening of fluorescent bacteria
According to the table 1 (isolates with no inhibition were not included), among of the 144 bacterial isolates, 23 isolates exhibited more than 30% inhibition of mycelia growth of Ph. drechsleri by non-volatile inhibitors. The maximum inhibition achieved by any isolate was 55.56% (CV3). Control plates not treated with the bacterial isolates were completely covered by the phytopathogens showing no inhibition (Table1). In tests for detection of volatile metabolites by isolates, eight isolates exhibited a more than 25% of mycelia growth of Ph. drechsleri. The maximum inhibition achieved by any isolate was 39.33% (V69). Isolates CV3, CV6, V11, V14, V69, V28, V16 and V64 were amongst the most effective isolates against Ph. drechsleri and selected for greenhouse studies. Isolates V16 and V64 produced noticeable amount of the volatile metabolites which inhibited mycelial growth by more than 30% (Table 1). The effect of bacterial isolates on the growth of seedlings was monitored by measuring of length and weight of the root and stem (Table 2). All strains except V69 promoted plant growth significantly compared to the untreated control. Strains CV6, V14 and V28 caused to increase the length of stem and root, considerably. In addition, strains CV6, V14 and V64 showed the most effect to enhance the foliar weight of cucumber seedling. However, both strains, CV6 and V14, exhibited the greatest effect to enhance root weight of seedling. In vitro root study of the colonization, demonstrated that some of the strains have more ability to root colonization than others. The population density on roots of plants treated with CV6 and V11 reached to 8.03 and 7.76 log10 CFU g-1 root respectively (Table 2). Strains V69 and V64 were not effective colonizers as their cell count was less than 5 log10 CFU g-1 root. Statistical analysis exhibited that there is a significant correlation between root colonization talent of strains and their growth promoting ability, as in most cases the strains with a higher efficacy of root colonization resulted in the more growth of plants (Table 3).
In greenhouse studies, mortality in pots treated with strain CV6 and V11 was very low and three weeks after treatment of pots with pathogen, percent of healthy plants in these treatments was 85.71 and 69.39%, respectively (Figure 1). Percent of healthy plants in pots treated with CV6 significantly was more than those treated with Ridomil. Moreover, there was no significant difference between fresh and dry weight of plants treated with isolate CV6 and non-infected control plants (Data not shown).
Identification and characterization of strain CV6
The result of biochemical and physiologic testing is listed in Table 4. Strain CV6 showed positive reactions of oxidase, gelatinase, nitrate reductase, arginine dihydrolase and levan production but it was negative for tobacco HR and growth at 41 �C. Primers, PS16f and PS16r amplified a complete DNA fragment of 1.49 kb 16S rDNA when the total genomic DNA of CV6 was used as template in PCR. The 16S rRNA gene sequence of this strain exhibited 99.1 % similarity to that of P. fluorescens.
Antiphytopathogenic activity of CV6 against several phytopathogens
P. fluorescens CV6 was shown to have broad spectrum in vitro antibiotic activity against 11 additional plant pathogens (Table 5). Fusarium oxysporum f. sp. lycopersici and Alternaria solani were the only pathogens tested that were not inhibited.
Detection and production of siderophore and IAA
The strain CV6 also showed the production of siderophore on CAS agar plates. Appearance of a reddish-brown zone surrounding the colony on CAS agar plates clearly suggests siderophore production by this strain. Strains P. fluorescens PF5, P. fluorescens CHA0, P. fluorescens 2-79, and P. aeruginosa 7NSK2 were used as reference strains. CAS activity by CV6 was significantly more than those of all the reference strains except 7NSK2 (Table 6). Specific tests were carried out for quantification of pyoverdine. Pyoverdine production by strain CV6 was significantly higher than those of CHA0 and PF5 but not those of other reference strains (Figure 2).
Strain CV6 was tested for the quantitative estimation of IAA in the presence of different concentrations of tryptophan (Figure 3). With no addition of tryptophan, production of IAA was not observed. With the addition of tryptophan from 50 to 500 mg/ ml the production of IAA was increased up to 15.3 �g/ml.
Assays for hydrolytic activity and detection of HCN
A remarkable change in color from yellow to reddish-brown with strain CV6 compared with the control indicates HCN production. The data revealed a decreased level of HCN production under low iron conditions (Table 7). Production of HCN by strain CHA0 was drastically dependent on iron concentration in the medium. Strain 7NSK2 was not able to produce HCN. Strain CV6 showed positive reactions for catalase, protease, and phosphatase, and negative for the production of pectinase, lipase and cellulase.
Discussion
Over the last decades, many studies have reported on natural activity of some fungi and bacteria against pathogens, and this is considered as a very appealing alternative to the use of chemical fungicides (Gerhardson 2002; Welbaum et al. 2004). The rhizosphere microorganisms, especially fluorescent pseudomonads, have exceptional ability to promote the growth of host plant by various mechanisms (O'Sullivan and O'Gara 1992). Also these bacteria have various mechanisms to suppress plant diseases including production of antibiotics, efficient root colonization and production of powerful siderophores (O'Sullivan and O'Gara 1992; Hass and Defago 2005). In our study, 144 bacterial strains were isolated from soil samples collected from agricultural fields of Varamin regione of Iran. All isolates subjected to several screening procedures for selecting the best strain for effective biocontrol of phytopathogens. Of all the strains tested, isolates CV3, CV6, V11, V14, V69, V28, V16 and V64 were amongst the most effective isolates against Ph. drechsleri and selected for further investigations. However, the main problem of biological control is its low consistency and reliability under field conditions due to a high variability in efficacy (Ojiambo, 2006). The complex in situ condition in the natural rhizosphere influences survival, growth and production of secondary metabolites by the biocontrol strains. One of the important measures in developing reliable biocontrol systems is to identify the biocontrol mechanisms and nutritional and physiological requirements of biocontrol agents to provide these optimum conditions in plant cultivation systems. Detailed characterization of a biocontrol agent is an essential step towards achieving this goal, and towards improving the level and reliability of its biocontrol activity. For example nutritional composition of root exudates in different plants is variable (Lugtenberg and Dekkers, 1999) and knowing the nutritional requirements of biocontrol agents will help us to introduce them to appropriate pathosystems. Moreover knowing the mechanisms of a biocontrol agent allow us to improve its efficacy. In the percent study, the ability of these strains for promotion of plant growth and efficient root colonization was investigated in vitro. Strains V14 and CV6 were able to significantly enhance all measured plant growth parameters. The strains with higher ability of root colonization were more effective in suppressing Phytophthora root rot on cucumber plants (Table 2 and Figure 1). In all most cases, strains with a higher efficacy of root colonization caused to higher growth of plants. In several works, variable performance of introduced rhizobacteria has been attributed to insufficient root colonization, a process whereby the bacteria inoculated onto seed attach to the root surface, and colonize the developing root system (Weller, 1988). On the other hand, the results of greenhouse studies revealed that, strains with higher ability of root colonization were more effective in suppressing Phytophthora root rot on cucumber plants. On the basis of these in vitro and in situ screening procedures, we selected strain CV6 for further investigations and characterization. This strain was identified as P. fluorescens using the biochemical and physiological tests as well as 16S rDNA sequence analysis. This procedure in identification is more accurate than the traditional methods (Weisburg, 1991; Guo et al., 2007). Strain CV6 revealed a broad spectrum antifungal activity against different phythopathogens and it can be used as an effective biological control candidate against devastating fungal pathogens that attack various plant crops. Results from this study exhibited that strain CV6 is partly powerful producer of IAA. There was an increase in the level of IAA with the increasing concentration of tryptophan (50-400 mg/ ml) similarly to the results reported by Barazani and Friedman (2000). IAA is responsible for division, enlargement and differentiation of plant cells and tissues; it plays a major role in xylem- and root formation (Davies, 1995). Auxin biosynthesis is also widespread among soil- and plant-associated bacteria. Moreover, its production is a determinant trait both for plant growth promoting rhizobacteria (PGPR) and plant pathogens (Patten and Glick, 1996, 2002). Another important trait of PGPR, that may indirectly influence the plant growth, is the production of siderophores. Siderophores chelates iron and other metals contribute to disease suppression by conferring a competitive advantage to biocontrol agents for the limited supply of essential trace minerals in natural habitats (Hofte et al., 1992; Loper and Henkels, 1997). Siderophores may directly stimulate the biosynthesis of other antimicrobial compounds by increasing the availability of these minerals to the bacteria. Results from the qualitative and quantitative estimations of siderophore by CV6 showed that, it's a powerful producer of siderophores. Strain CV6 showed positive reactions for catalase, protease, phosphatase and HCN. Solubilization of phosphorous because of phosphatase were found to significantly increase crop yield (Brown 1974) and bacterial strains showing catalase activity must be highly resistant to environmental, mechanical, and chemical stresses (Joseph et al., 2007). Production of HCN by pseudomonads is associated with biological control of the black root rot of tobacco, but other workers observed that it can have a detrimental effect on plant growth (O'Sullivan and O'Gara, 1992).
Acknowledgment
We gratefully acknowledge financial support from the Islamic Azad University of Varamin-Pishva, Varamin.
[Reference]
References
Ahmadzadeh M, Sharifi-Tehrani A (2009) Evaluation of fluorescent pseudomonads for plant growth promotion, antifungal activity against Rhizoctonia solani on common bean, and biocontrol potential. Biological Control 48:101-107
Ahmed Idris H, Labuschagne N, Korsten L (2007) Screening rhizobacteria for biological control of Fusarium root and crown rot of sorghum in Ethiopia. Biological control 40: 97- 106
Alexander DB, Zuberer, DA (1991) Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol. Fertil. Soils. 12:39-45
Ayers SH, Rupp P, Johnson WT (1919) A study of the alkaliforming bacteria in milk. U. S. Dept. of Agric. Bull. 782
Barazani O, Friedman J (2000) Effect of exogeneously applied L-tryptophan on allelochemical activity of plant growth promoting rhizobacteria (PGPR). J. Chem. Ecol. 26:343-349
Bloemberg GV, Lugtenberg BJ (2001) Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Current Opinion Plant Biology. 4:343-350
Brown ME. (1974) Seed and root bacterization. Annual Review of Phytopathology 12: 181-197.
Cattelan AJ, Hartel PG, Fuhrmann JJ (1999) Screening for plant growth promoting rhizobacteria to promote early soybean growth. Soil Science Society of American Journal 63:1670- 1680
Chambers CE, Meintrye DD, Mouckn M, Solok PA (1996) Physical and structural characterization of yersiniophore, a siderophore produced by clinical isolate of Yersinia enterolitica. Biometal 19:7-16
Colyer PD, Mount MS (1984) Bacterization of potatoes with Pseudomonas putida and its influence on post harvest soft rot diseases. Plant Disease 68:703-706
Davies P. (1995) The plant hormone concept: concentration, sensitivity, and transport. In: hormones: physiology, biochemistry, and molecular biology, ed. by Davies, P., pp. 13-18. Plant Kluwer Academic Publishers, Dordrecht,
Defago G, Haas D (1990) Pseudomonads as antagonists of soil borne plant pathogens: mode of action and genetic analysis. Soil Biochem. 6:249-291.
Dye DW (1968) A taxonomic study of the genus Erwinia. I. the "amylovora" group. New Zealand J. Sci. 11:590-607
Gardner JM, Chandler L, Feldman AW (1984) Growth promotion and inhibition by antibiotics producing fluorescent Pseudomonads on citrus root. Plant Soil 77:103-113
Gerhardson B (2002) Biological substitutes for pesticides. Trends in Biotechnology 20:338-343
Guo Y, Zheng H, Yang Y. Wang H (2007) Characterization of Pseudomonas corrugata strain P94 isolated from soil in Beijing as a potential biocontrol agent. Curr Microbiol 55:247-253
Hofte M, Boelens J, Verstraete, W (1992) Survival and root colonization of mutants of plant growth promoting pseudomonads affected in siderophore biosynthesis or regulation of siderophore production. J. Plant Nutr. 15:2253- 2262.
James DW, Gutterson NI (1986) Multiple antibiotics produced by Pseudomonas fluorescens HV37a and their differential regulation by glucose. Applied and Environmental Microbiology 52:1183-1189
Johri BN, Rao CV. S, Goel R (1997) Fluorescent Pseudomonads in plant disease management. In: Biotechnological approaches in soil microrganism for sustainable crop production, Ed. by K. R. Dadarwal and Jodhpur, pp. 193-221. India: Scientific Publishers
Joseph B, Ranjan Patra R, Lawrence R (2007) Characterization of plant growth promoting rhizobacteria associated with chickpea (Cicer arietinum L.). International Journal of Plant Production. 1:141-151
Keel C, Schnider U, Maurhofer M, Voisard C, Laville J, Burger U, Wirthner P, Haas D. and Defago G (1992) Suppression of root diseases by Pseudomonas fluorescens CHAO: importance of bacterial secondary metabolite, 2,4- diacetylphoroglucinol. Mol. Plant-Microbe Interact. 5:4-13
Keel C, Voisard C, Berling CH, Kadr G, Defago G (1989) Iron sufficiency, a prerequisite for the suppression of tobacco root rot by Pseudomonas fluorescens strain CHAO under gnotobiotic conditions. Phytopathology 79:584-589
King EO, Ward MK, Raney DE (1954) Two simple media for the demonstration of pyocyanin and fluorescin. 1. Lab. Clin. Med. 44:301-307
Klement Z (1963) Rapid detection of the pathogenicity of phytopathogenic pseudomonads. Nature 199:299-300
Kloepper JW, Leong J, Teintze M, Schroth MN (1980) Enhanced plant growth by siderophores produced by plant growth promoting rhizobacteria. Nature 268:885-886
Kovacs N (1956) Identification of Pseudomonas pyocyanea by the oxidase reaction. Nature 178: 703
Kraus J, Loper JE (1992) Lack of evidence for a role of antifungal metaoolite production by Pseudomonas fluorescense PF5 in biological control of Pythium dampingoff of cucumber. Phytopathology 82:264-271
Lifshitz R, Kloepper JW, Kozlowski M, Simonson C, Carlson J, Tipping EN, Zaleska I (1987) Growth promotion of canola (rapeseed) seedlings by a strain of Pseudomonas putida under gnotobiotic conditions. Can. J. Microbiol. 8:102-106
Loper JE, Buyer JS (1991) Siderophore in microbial interactions on plant surfaces. Mol. Plant-Microbe Interact. 4:5-13
Loper JE, Henkels MD (1997) Availability of iron to Pseudomonas fluorescence in rhizosphere and bulk soil evaluated with an ice nucleation reporter gene. Appl. Environ. Microbiol. 63:99-105
Loper JE, Scroth MN (1986) Influence of bacterial sources on indole-3 acetic acid on root elongation of sugarbeet. Phytopathology 76:386-389
Lorck H (1948) Production of hydrocyanic acid by bacteria. Physiol. Plant. 1:142-146
Lugtenberg BJJ, Dekkers LC (1999) What makes Pseudomonas bacteria rhizosphere competent? Environ. Microbiol. 1:9-13
Meyer JM, Abdallah MA (1978) The fluorescent pigment of Pseudomonas fluorescens: biosynthesis, purification and physicochemical properties. J. Gen. Microbiol. 107:319-328
Miller JH (1974) Experiments in Molecular Genetics, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press
Mitchell JK, Carter WE (2000) Modeling antimicrobial activity of Clorox(TM) using an agar-diffusion test: a new twist on an old experiment. Bioscenece 26:9-13
Moeinzadeh A, Sharif-Zadeh F, Ahmadzadeh M, Heidari Tajabadi F (2010) Biopriming of sunflower (Helianthus annuus L.) seed with Pseudomonas fluorescens for improvement of seed invigoration and seedling growth. Australian Journal of Crop Science. 4:564-570.
Neiland JB, (1995) Siderophore: structure and function of microbial iron transport compounds. J. Biol. Chem. 270:26723-26726
Ojiambo PS, Scherm H (2006) Biological control and application-oriented factors influencing plant disease suppression by biological control: A meta-analytical review. Phytopathology 96:1168-74
O'Sullivan DJ, O'Gara F (1992) Traits of fluorescent Pseudomonas spp. involved in suppression of plant root pathogens. Microbiol. Rev. 56:662-676
Patten C, Glick B (1996) Bacterial biosynthesis of indole-3- acetic acid. Can. J. Microbiol. 42: 207-220
Patten C, Glick B (2002) Role of Pseudomonas putida indole acetic acid in development of the host plant root system. Appl. Environ. Microbiol. 68:3795-3801
Pierson EA Weller DM (1994) Use of mixtures of fluorescent Pseudomonads to suppress take-all and improve the growth of wheat. Phytopathology 84:940-947
Pikovskaya, RI (1948) Mobilization of phosphorous in soil in connection with vital activity of some microbial species. Mikrobiologiya 17:363-370.
Rangajaran S, Saleena L M, Vasudevan P, Nair S (2003) Biological suppression of rice diseases by Pseudomonas spp. under saline soil conditions. Plant Soil 251:73-82
Sambrook J, Fritsch FE, Maniatis TA (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Schaad NW, Jones JB, Chun W (2001) Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. APS Press, MN, 373 pp
Shaad NW, Jones JB, Chun W (2001) Laboratory guide for identification of plant pathogenic bacteria. Third edition. APS press, MN
Schippers B, Bakker AW, Bakker PAHM (1987) Interactions of deleterious and beneficial rhizosphere microorganisms and the effect of cropping practices. Annual Review of Phytopathology 25:339-358
Smibert RM, Krieg NR (1994) Phenotypic characterization. In: Methods for General and Molecular Biology, ed. by P.R.G. Gerhardt, E. Murray, W.A. Wood, and N.R. Krieg, pp. 607- 654. Washington, DC: American Society for Microbiology
Sunish Kumar R, Ayyadurai N, Pandiaraja P, Reddy AV, Venkateswarlu Y, Prakash O, Sakthivel N (2005) Characterization of antifungal metabolite produced by a new strain Pseudomonas aeruginosa PUPa3 that exhibits broadspectrum antifungal activity andvbiofertilizing traits. Journal of Applied Microbiology 98:145-154
Thornley Ml (1960) The differentiation of Pseudomonas from other Gram negative bacteria on the basis of arginine metabolism. Appl. Bacteriol. 1:37-52
Villacieros M, Power B, Sanchez-Contreras M, Loret J, Oruzebal RI, Martin M, Franandez-Pinas F, Bouile I, Whelan C, Dowling DN, Rivilla R (2003) Colonization behaviour of Pseudomonas fluorescens and Sinorhizobium meloti in the alfalfa (Medicago sativa) rhizosphere. Plant Soil 251:47-54
Wang C, Ramette A, Punjasamarnwong P, Zala M, Natsch A, Moenne-Loccoz Y, Defago G (2001) Cosmopolitan distribution of phlD-containing dicotyledonous cropassociated biocontrol pseudomonads of worldwide origin. FEMS Microbiology Ecology 37:105-116
Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S Ribosomal DNA Amplification for Phylogenetic Study. Journal of Bacteriology 173:697-703
Welbaum G, Sturz AV, Dong Z, Nowak J (2004) Fertilizing soil microorganisms to improve productivity of agroecosystems. Critical Reviews in Plant Sciences 23:175- 193
Weller DM (1988) Biological control of soil borne plant pathogens in the rhizosphere with bacteria. Ann. Rev. Phytopathol. 26:379-407.
Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S Ribosomal DNA Amplification for Phylogenetic Study. Journal of bacteriology 173:697-703.
Yuen GY, Schroth MN (1986) Interaction of Pseudomonads fluorescens strains E6 with ornamental plants and its effect on the composition of root colonization microflora. Phytopathology 76:176-179.
[Author Affiliation]
M. Maleki*1, S. Mostafaee1, L. Mokhtarnejad2 & M. Farzaneh2
1Department of plant protection, Islamic Azad University of Varamin-Pishva, Varamin, Iran
2Department of plant protection, University of Tehran, Iran
*Corresponding author: mojdehmaleki@iauvaramin.ac.ir
NEW YORK (AP) — Birds are chirping, the grass is green and tea is being served amid blossoming bushes.
Welcome to New York City in January, with a cure for cold-weather blues: a pop-up indoor park that's open through Valentine's Day.
Despite temperate temperatures so far this year, "it's our rebellion against winter," says Jonathan Daou, founder and CEO of Openhouse Gallery, which holds a 20-year lease on the space.
The 5,000-square-foot (464-square-meter) artificial habitat, called Park Here, is filled with trees, rocks, picnic benches and the recorded ambient sounds of Central Park in spring. On a recent weekday afternoon, babies played barefoot in the 75-degree (23 degrees Celsius) world while their parents ate cookies and sandwiches.
A movie night is planned on the lawn. Other days bring a ping pong competition, a trivia contest, wine tastings and soccer workshops.
But the park will be gone by mid-February.
The rest of the year, the space is a stage for business that plays on the "pop-up" retail method: a quick presentation of a product, performance or personality, with no commitment to a lease or contract. It's usually set up in a mobile unit that can be assembled and disappear.
Since its inception four years ago, Openhouse Gallery has created installations for high-end clients such as auto manufacturer Mercedes-Benz, a group of Italian leather tanneries and Google. Other setups involved skating and stadium seating for World Cup soccer viewing.
In August, Jay-Z and Kanye West used Openhouse Gallery for the rollout of their "Watch The Throne" album. When Jay-Z tweeted "201 Mulberry Street, NYC," thousands of people swarmed outside.
"It's .2 acres with so much positive energy," Daou says.
The garden is free to the public and open daily noon to 8 p.m.
The rest of the year, clients pay $4,000 to $8,000 a day for the venue.
___
Online:
http://www.openhousegallery.org
JERUSALEM (AP) — Israel's military said Saturday that surveillance footage from drones shows that the explosions that rocked a village in southern Lebanon this week occurred at a residential building used by Hezbollah as a weapons depot.
A series of blasts ripped through a building in the Hezbollah-dominated village of Shehabiyeh on Friday. There did not appear to be any casualties from the blasts, which set off a large fire. Hezbollah, which is backed by Iran, did not comment on the nature of the explosions or whether the building had been used to store weapons.
Israeli military spokeswoman Lt. Col. Avital Leibovich told The Associated Press Saturday that footage from Israeli drones shows suspected Hezbollah militants removing weapons from the site and transferring them to other Hezbollah facilities.
Leibovich said it was the third time this year that explosions have torn through a suspected Hezbollah weapons cache. She also accused the group of maintaining military facilities — including bunkers and storage depots for large quantities of weapons — in 160 villages across southern Lebanon.
She alleged that the caches include the type of rockets that Hezbollah launched by the hundreds on northern Israeli cities during the 2006 war.
Friday's blasts occurred south of the Litani River, the zone where Hezbollah is banned from keeping weapons under a U.N. resolution that ended the 2006 war between the Shiite militants and Israel.
The area is patrolled by a U.N. peacekeeping force, known as UNIFIL, as well as Lebanese soldiers and has been largely peaceful since the conflict. UNIFIL said Saturday that it was still investigating Friday's incident, but that it had no reports of suspicious activities.
MORGANTOWN - Much like one of Charleston's would-be mayoralcandidates, the University of Georgia does not reside in an area itcould otherwise rule.
Thus the Bulldogs, after Wednesday's 75-63 win at West VirginiaUniversity, cannot be considered the basketball kings of theMountainState. Nonetheless, Georgia, including last week's 78-73 win overvisiting Marshall, has conquered both of West Virginia's Division Iprograms.
Second-year Bulldog Coach Ron Jirsa was asked to assess the twoteams."Not to compare them, " Jirsa said in the opening qualifier."... Marshall has great guards. In the open court, they aretough. West Virginia, (forward) Marcus Goree is about as good aswe've seen. (The teams) have a little contrast. (Marshall guard)Travis Young played a great game against us. He was all we couldhandle."WVU and Marshall had something in common Wednesday.They both lost to teams they defeated in 1997-98.The only other 1998-99 foe shared by the two, who meet Jan. 27 inCharleston, will be Ohio University.- n nOne potentially enthralling matchup, that between talented, high-leaping forwards Marcus Goree from WVU and Jumaine Jones fromGeorgia, never materialized.Goree did his part, making his first 10 shots and leading allscorers with 23 points. His two one-handed dunks were the mostmemorable of the evening's 53 baskets."We put our center on Goree," Jirsa said of the game's start. "Hewas a little too quick for him. He's showing he's one of the bestforwards in this part of the country."The Bulldogs' leading scorer entering the contest, Jones struggledfor the second consecutive season against WVU. He made 4-of-15 fromthe field in last December's 86-81 WVU win at Atlanta's GeorgiaDome.In the Coliseum, Jones hit just 1-of-12 shots, that a dunk with5:20 left. He finished with nine points and six rebounds in 36minutes. For the second straight season, Goree blocked a near-basketJones attempt."I just wasn't able to hit shots," said the 6-foot-7, 215-poundJones, a third-team All-Southeastern Conference selection lastseason."He's giving up a lot of size at power forward," Jirsa said.Georgia instead was led by less-heralded forward Michael Chadwick,who scored a season-high 20 points with 10 rebounds.One thing in WVU's favor was unfamiliarity. Bulldog point guardG.G. Smith said he recognized a face from last season's game."I only knew big Goree," Smith said.- n nThe game ended a two-game series between unlikely foes. Bothgames were entertaining. Last season, WVU held a 17-pointsecond-half lead, was tied, then, with the help of 25 Georgiaturnovers, recovered to win."I like the series," Smith said.What Smith missed was playing before a full Coliseum."I thought the fans would be more rowdy," said Smith, who guidedan offense that committed just two second-half turnovers.Few in the Big East want to enter a Coliseum as rambunctious asthe one that confronted Connecticut last February.The visit was the first to Morgantown by an SEC team since Georgialost in a first-round NIT game in 1993.- n nDribbles and other drivel:- WVU Coach Gale Catlett and several of his players refused to usethis week's lengthy trip back from the Big Island Invitational inHawaii as an excuse for losing."I don't think fatigue had anything to do with it," Mountaineerforward Elton Scott said.- The loss ended a win streak of 19 in non-conference home gamesfor WVU. The last defeat was 83-73 to Virginia Tech in 1994-95. TheMountaineers dropped a third-round NIT game to Florida State at theColiseum to end the 1996-97 season.Writer Mike Cherry can be reached at 348-5170.
The Senate Banking Committee chairman says the U.S. government's financial rescue plan will be costly and is demanding more details about the program to confront the worst financial crisis in decades.
Sen. Chris Dodd told reporters, "We're anxious to hear the specifics. None of us have any idea what the details are. We understand the gravity of the moment."
Republicans and Democrats on Dodd's panel met and emerged vowing to put politics aside and develop a solution to the financial crisis. Dodd is a Democrat.
Gusty winds from the southwest will boost temperatures into the70s today. Moisture from the Gulf of Mexico will also move into theMidwest, giving much of Illinois the threat of showers andthunderstorms this afternoon.
If enough energy in the upper atmosphere joins with thelow-level warm and humid air, some of these storms could becomestrong or severe late this afternoon and this evening.
A weak cool front is due Friday, with a continuing chance ofshowers and thundershowers. The rather complex weather system willmove east Saturday, ending the threat of showers and ushering inslightly cooler temperatures.The main body of chilly air will stay well north of Chicago,but it might be a good idea to take along a light jacket thisweekend.Overall, the jet stream pattern suggests temperatures willaverage near or slightly above average, with more frequent showeryspells into next week. Another low pressure system is expected tomove into the area by next Tuesday with more welcome rainfall.Tom Bobula is filling in for Paul Douglas.Weather QuizWhich of the following is the best absolute measure of atmosphericmoisture?A) Relative humidityB) Dew pointC) Cloud metersD) Rain bucketsAnswer: (B) Dew point is the temperature to which air must becooled for saturation to occur. Relative humidity is the second-bestmeasure of moisture, but as the name implies, is relative to thecurrent temperature.Weather FactSevere thunderstorms are defined as having one or more of thefollowing: tornadoes, winds of 58 m.p.h. or greater, significant winddamage, or hail 3/4; - inch diameter or larger.;
CODY, Wyo. - Residents waved American flags as they lined the streets of the late U.S. Sen. Craig Thomas's hometown Sunday to say goodbye to the longtime Republican leader.
Thomas, 74, died June 4 during treatment for leukemia. Hundreds of people turned out for his funeral Saturday in Casper.
On Sunday, Thomas' casket was driven through the town where he was born, following the route of the annual July Fourth parade that Thomas used to ride in.
Some well-wishers held up signs of support, and Thomas' wife, Susan, waved on the way to a private burial.
The three-term Republican senator and former U.S. Marine grew up on a Wapiti ranch, between Cody and Yellowstone National Park. He graduated from Cody High School.
KANSAS CITY, Mo. (AP) — Delmon Young homered and drove in two runs and the Minnesota Twins beat the Kansas City Royals 4-2 on Wednesday night to snap a season-long five-game losing streak.
Young, the first overall pick in the 2003 draft, hit his 20th homer with one out in the seventh on a full-count changeup from Gil Meche (0-5). The ball clipped the left-field pole.
Young's single in the ninth scored Orlando Hudson, who had doubled, with the final run.
Matt Capps worked the ninth for his 16th save in 18 opportunities since the Twins acquired him in a July 29 trade with the Pittsburgh Pirates.
Capps had to work around a leadoff pinch-hit single by Gregor Blanco and a walk to Jarrod Dyson. He struck out Mike Aviles and ended the game with Billy Butler grounding into his major league-leading 31st double play.
The Royals took a 2-0 lead in the second. Rookie Kila Ka'aihue led off with his eighth home run. He hit two home runs Tuesday. Lucas May's single scored Alex Gordon, who had walked and advanced to third on a double by Yuniesky Betancourt.
The Twins tied it in the sixth when Royals right-hander Luke Hochevar gave up singles to Michael Cuddyer and Danny Valencia, who had three hits, and walked Jason Repko to load the bases with one out. Drew Butera lined a single to left to score Cuddyer. Alexi Casilla's fielder's choice groundout scored Valencia with the second run.
Twins starter Scott Baker, who missed three September starts after receiving a cortisone shot in his right elbow, left after five innings, allowing two runs, six hits and four walks, striking out nine.
Matt Guerrier (5-7), the second of four Minnesota pitchers, picked up the victory, striking out four of the five batters he faced. The Royals struck out a season-high 15 times.
The Royals stranded eight runners from the second through fifth innings, going 1 for 11 with runners in scoring position in that span.
Hochevar, making his final start of the season, gave up two runs and seven hits in six innings.
Notes: Twins 1B Justin Morneau, who has not played since July 7 because of a concussion, is scheduled for a full workout before the game Thursday at Target Field. ... Royals OF Mitch Maier missed his fourth straight game with a sore left knee. ... The Royals have won 65 games, matching their win total for 2009, but have lost 93 games, the eighth time in the past 10 seasons they have lost 90 or more.
